Entry information : SmPrx99-1_50 (SmPrx99a_50)
Entry ID 7124
Creation 2009-11-02 (Paula Nunes)
Last sequence changes 2009-11-02 (Paula Nunes)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2014-01-16 (Qiang Li)
Peroxidase information: SmPrx99-1_50 (SmPrx99a_50)
Name (synonym) SmPrx99-1_50 (SmPrx99a_50)
Class Class III peroxidase    [Orthogroup: Prx073]
Taxonomy Eukaryota Viridiplantae Streptophyta Isoetopsida Selaginellaceae Selaginella
Organism Selaginella moellendorffii    [TaxId: 88036 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SmPrx99-1_50
start..stop
S start..stop
SmPrx102-1_50 597 0 1..314 1..314
SmPrx98-1_50 590 0 1..314 1..314
SmPrx98-2_9 583 0 1..314 1..314
SmPrx101-1_50 576 0 1..314 1..314
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1115112..1115360 249 N° 2 1115405..1115563 159 N° 3 1115614..1116150 537  
join(1115112..1115360,1115405..1115563,1115614..1116150)


exon

Literature and cross-references SmPrx99-1_50 (SmPrx99a_50)
DNA ref. Phytozome 12:   scaffold_50 (1115112..1116150)
mRNA ref. JGI transcript:   115011 [Incorrect prediction]
Protein sequence: SmPrx99-1_50 (SmPrx99a_50)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   314 (286)
PWM (Da):   %s   33721.34 (30584.5)  
PI (pH):   %s   9.78 (8.61) Peptide Signal:   %s   cut: 29 range:29-314
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MQRSKLQAPVASAALLLVLALLRRYAFRQGSPTMSSELSTSFYASTYPDLPQIVRSVIHSEFSNDSRSAASILKLHFRDCFSRGCDGSLLLQRGDGRSAKGLKTINNVKRAVETSCPATVSCADILALSARESVIALGGPSWTVEFGRRDSPATVAAAMEAIPSPNLTATQLIQSFQRRGLSKRDLVALSGGHSIGQAQCSAFSARLFNGTPGDSIDRAFKSRLEKNCPPTAPDKLTNLDPSPTTFDNLYFRALLANQSLLFSDQQLLEIDLVGFVKEFAANQQTFFTAFANGMIKMGKLSPITGGHGEIRSSC*

Retrieve as FASTA  
Remarks Complete sequence from genomic (introns 1 and 2). Incorrect prediction from JGI: short SP. and probably error sequecing or a pseudogene: no first C in the first exon. The scaffold has not been completemently sequenced. No ESTs. No variant allelic! Missing 'c'.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCAGCGATCCAAACTCCAGGCTCCAGTCGCCTCTGCGGCATTACTCCTGGTGCTAGCACTGCTGCGGCGCTATGCATTTCGCCAGGGATCACCAACAATGTCATCGGAGCTCTCAACT
TCTTTCTATGCTAGCACTTATCCCGATCTCCCTCAGATCGTGAGAAGTGTGATTCACTCTGAATTTTCCAACGACAGTCGATCTGCTGCGTCGATCCTCAAGCTCCACTTCCGAGATTGC
TTCTCTCGA
GTAAGTCAGAAATTAAAATAGCGTTACTCATTTATGGCTGCCAGGGCTGCGACGGATCGCTGCTCCTCCAGCGAGGAGATGGGCGCTCCGCCAAGGGACTCAAAACCATCA
ACAACGTCAAGCGCGCCGTGGAGACTTCATGCCCGGCAACAGTATCGTGCGCAGACATTCTTGCGCTGAGCGCCCGGGAATCCGTCATAGCT
GTGAGTGAGACTCTCCATCTTGAGTTGA
TCATTCTCTTTCGACTTTGCAGCTGGGCGGCCCTTCATGGACAGTAGAATTTGGCCGACGGGACAGTCCTGCGACCGTCGCCGCCGCAATGGAGGCCATTCCCAGCCCAAACCTCACTGC
AACGCAGCTCATCCAGAGCTTCCAAAGGCGGGGTCTTTCCAAGCGTGATCTCGTAGCGCTTTCAGGAGGCCACTCCATCGGCCAGGCCCAGTGCTCTGCATTTAGCGCACGCCTCTTCAA
TGGAACCCCAGGAGATAGCATCGATCGGGCCTTCAAATCTCGACTCGAGAAGAATTGCCCTCCAACAGCCCCAGACAAATTGACCAATTTGGATCCATCCCCCACCACCTTCGACAACTT
GTACTTTCGAGCTCTCCTGGCGAATCAGTCGCTCCTCTTTTCAGACCAGCAGCTCTTGGAGATTGATCTGGTGGGCTTTGTCAAGGAGTTTGCGGCCAACCAGCAGACATTCTTTACCGC
CTTCGCCAATGGCATGATCAAAATGGGCAAGCTCTCGCCAATCACAGGAGGGCATGGTGAAATTCGATCCTCGTGCTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCAGCGATCCAAACTCCAGGCTCCAGTCGCCTCTGCGGCATTACTCCTGGTGCTAGCACTGCTGCGGCGCTATGCATTTCGCCAGGGATCACCAACAATGTCATCGGAGCTCTCAACT
TCTTTCTATGCTAGCACTTATCCCGATCTCCCTCAGATCGTGAGAAGTGTGATTCACTCTGAATTTTCCAACGACAGTCGATCTGCTGCGTCGATCCTCAAGCTCCACTTCCGAGATTGC
TTCTCTCGA
GGCTGCGACGGATCGCTGCTCCTCCAGCGAGGAGATGGGCGCTCCGCCAAGGGACTCAAAACCATCAACAACGTCAAGCGCGCCGTGGAGACTTCATGCCCGGCAACAGTA
TCGTGCGCAGACATTCTTGCGCTGAGCGCCCGGGAATCCGTCATAGCT
CTGGGCGGCCCTTCATGGACAGTAGAATTTGGCCGACGGGACAGTCCTGCGACCGTCGCCGCCGCAATGGAG
GCCATTCCCAGCCCAAACCTCACTGCAACGCAGCTCATCCAGAGCTTCCAAAGGCGGGGTCTTTCCAAGCGTGATCTCGTAGCGCTTTCAGGAGGCCACTCCATCGGCCAGGCCCAGTGC
TCTGCATTTAGCGCACGCCTCTTCAATGGAACCCCAGGAGATAGCATCGATCGGGCCTTCAAATCTCGACTCGAGAAGAATTGCCCTCCAACAGCCCCAGACAAATTGACCAATTTGGAT
CCATCCCCCACCACCTTCGACAACTTGTACTTTCGAGCTCTCCTGGCGAATCAGTCGCTCCTCTTTTCAGACCAGCAGCTCTTGGAGATTGATCTGGTGGGCTTTGTCAAGGAGTTTGCG
GCCAACCAGCAGACATTCTTTACCGCCTTCGCCAATGGCATGATCAAAATGGGCAAGCTCTCGCCAATCACAGGAGGGCATGGTGAAATTCGATCCTCGTGCTAG

Retrieve as FASTA