Entry information : SmPrx107-1_48 (SmPrx107a_48)
Entry ID 7132
Creation 2009-11-16 (Paula Nunes)
Last sequence changes 2009-11-16 (Paula Nunes)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2011-01-25 (Toky Ramarohetra (Scipio))
Peroxidase information: SmPrx107-1_48 (SmPrx107a_48)
Name (synonym) SmPrx107-1_48 (SmPrx107a_48)
Class Class III peroxidase    [Orthogroup: Prx077]
Taxonomy Eukaryota Viridiplantae Streptophyta Isoetopsida Selaginellaceae Selaginella
Organism Selaginella moellendorffii    [TaxId: 88036 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SmPrx107-1_48
start..stop
S start..stop
SmPrx89-1_24 635 0 1..318 1..318
SmPrx93-2_26 632 0 1..318 1..318
SmPrx92-1_24 624 0 1..318 1..318
SmPrx92-2_26 624 0 1..318 1..318
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1058828..1059031 204 N° 2 1058584..1058766 183 N° 3 1057945..1058514 570  
complement(join(1057945..1058514,1058584..1058766,1058828..1059031))


exon

Literature and cross-references SmPrx107-1_48 (SmPrx107a_48)
DNA ref. Phytozome 12:   scaffold_48 (1059031..1057945)
mRNA ref. JGI transcript:   114366
Protein sequence: SmPrx107-1_48 (SmPrx107a_48)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   318 (298)
PWM (Da):   %s   33873.7 (31836.6)  
PI (pH):   %s   7.99 (7.98) Peptide Signal:   %s   cut: 21 range:21-318
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAIMSFVLVLLLALHGSALGQTLNSSFYRSSCPNLTTIVRAAVQQAVQAEARIAASFVRLHFHDCFVNGCDASILLDGTNLEQNAFPNAGSARGFDIVDSIKSSVESSCPGVVSCADLLALIARDSVVALNGPSWTVVFGRRDSLTASQSAANANLPPPTLNASALITSFQNQGLSTTDMVALSGAHTIGQARCTTFKARLYGPFQRGDQMDQSFNTSLQSSCPSSNGDTNLSPLDVQTPTSFDNRYFRNLQSRRGLLFSDQTLFSGNQASTRNLVNSYASSQSTFFQDFGNAMVRMGNINVLTGSNGEIRRNCGRTN*

Retrieve as FASTA  
Remarks Complete sequence from genomic (introns 1 and 2). PS missing 3 aa. No ESTs. No allelic variant.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGATCATGTCCTTCGTGCTTGTGTTGTTGCTGGCTCTGCATGGAAGTGCTCTGGGCCAAACTTTGAACTCCAGCTTCTACCGCTCCTCGTGCCCAAATCTCACCACCATCGTGAGA
GCTGCAGTGCAGCAGGCCGTCCAGGCAGAGGCTCGAATCGCAGCCTCGTTTGTTCGCCTCCATTTCCACGACTGCTTTGTCAAT
GTAGAAAGCTTCCATAACTTTCATTCAAGCATATTG
AAAGAACCATGCATTTGTCTTGCAGGGATGCGATGCTTCCATTCTTCTCGACGGCACAAACCTGGAGCAAAACGCGTTTCCAAACGCTGGCTCCGCCCGTGGCTTCGACATCGTCGACTC
CATCAAGAGCTCCGTCGAGAGCTCCTGCCCGGGTGTTGTCTCCTGCGCTGACTTACTGGCGCTCATTGCCCGGGACTCCGTAGTCGCG
GTAAACTCTCAAAGTGAACGGTCAAAAGCTTA
CAATGTCAACGCTTTTCGTTTTGTGGTGTTTTTACAGCTGAACGGGCCTTCGTGGACGGTGGTGTTTGGAAGGAGGGATAGCTTAACAGCAAGCCAATCTGCCGCAAATGCCAACCTTCC
TCCTCCAACTTTGAATGCCTCAGCTCTCATCACGAGTTTTCAAAACCAGGGGCTTTCAACCACAGATATGGTGGCTCTCTCCGGGGCTCACACCATTGGGCAGGCCCGGTGCACCACCTT
TAAGGCTCGGCTCTACGGGCCCTTCCAAAGAGGTGACCAGATGGATCAAAGTTTTAACACCTCGTTGCAAAGCTCGTGCCCGAGCAGCAATGGCGACACCAATCTCTCGCCGCTCGACGT
CCAGACGCCCACCAGCTTTGACAATCGCTACTTTAGGAACTTGCAGAGTCGGAGAGGGTTGCTTTTCTCGGACCAGACGCTCTTTTCGGGGAACCAGGCCAGCACGAGGAATCTCGTCAA
CTCATACGCTTCGAGCCAGAGCACTTTCTTCCAGGACTTTGGCAATGCAATGGTAAGGATGGGCAATATCAATGTGTTGACTGGATCCAATGGAGAGATTCGAAGAAACTGTGGAAGAAC
AAACTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGATCATGTCCTTCGTGCTTGTGTTGTTGCTGGCTCTGCATGGAAGTGCTCTGGGCCAAACTTTGAACTCCAGCTTCTACCGCTCCTCGTGCCCAAATCTCACCACCATCGTGAGA
GCTGCAGTGCAGCAGGCCGTCCAGGCAGAGGCTCGAATCGCAGCCTCGTTTGTTCGCCTCCATTTCCACGACTGCTTTGTCAAT
GGATGCGATGCTTCCATTCTTCTCGACGGCACAAAC
CTGGAGCAAAACGCGTTTCCAAACGCTGGCTCCGCCCGTGGCTTCGACATCGTCGACTCCATCAAGAGCTCCGTCGAGAGCTCCTGCCCGGGTGTTGTCTCCTGCGCTGACTTACTGGCG
CTCATTGCCCGGGACTCCGTAGTCGCG
CTGAACGGGCCTTCGTGGACGGTGGTGTTTGGAAGGAGGGATAGCTTAACAGCAAGCCAATCTGCCGCAAATGCCAACCTTCCTCCTCCAACT
TTGAATGCCTCAGCTCTCATCACGAGTTTTCAAAACCAGGGGCTTTCAACCACAGATATGGTGGCTCTCTCCGGGGCTCACACCATTGGGCAGGCCCGGTGCACCACCTTTAAGGCTCGG
CTCTACGGGCCCTTCCAAAGAGGTGACCAGATGGATCAAAGTTTTAACACCTCGTTGCAAAGCTCGTGCCCGAGCAGCAATGGCGACACCAATCTCTCGCCGCTCGACGTCCAGACGCCC
ACCAGCTTTGACAATCGCTACTTTAGGAACTTGCAGAGTCGGAGAGGGTTGCTTTTCTCGGACCAGACGCTCTTTTCGGGGAACCAGGCCAGCACGAGGAATCTCGTCAACTCATACGCT
TCGAGCCAGAGCACTTTCTTCCAGGACTTTGGCAATGCAATGGTAAGGATGGGCAATATCAATGTGTTGACTGGATCCAATGGAGAGATTCGAAGAAACTGTGGAAGAACAAACTAG

Retrieve as FASTA