Entry information : SmPrx41-2_71 (SmPrx41b_71)
Entry ID 7141
Creation 2009-11-18 (Paula Nunes)
Last sequence changes 2009-11-18 (Paula Nunes)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2011-01-25 (Toky Ramarohetra (Scipio))
Peroxidase information: SmPrx41-2_71 (SmPrx41b_71)
Name (synonym) SmPrx41-2_71 (SmPrx41b_71)
Class Class III peroxidase    [Orthogroup: Prx283]
Taxonomy Eukaryota Viridiplantae Streptophyta Isoetopsida Selaginellaceae Selaginella
Organism Selaginella moellendorffii    [TaxId: 88036 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SmPrx41-2_71
start..stop
S start..stop
SmPrx41-1_51 683 0 1..336 1..336
EgrPrx94 271 4e-90 1..333 1..321
EglPrx94 271 5e-90 1..333 1..321
MePrx118 268 1e-88 53..333 51..340
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 148615..148908 294 N° 2 148379..148558 180 N° 3 148170..148329 160 N° 4 147731..148107 377
complement(join(147731..148107,148170..148329,148379..148558,148615..148908))


exon

Literature and cross-references SmPrx41-2_71 (SmPrx41b_71)
DNA ref. Phytozome 12:   scaffold_71 (148908..147731)
mRNA ref. JGI transcript:   123452 [Incorrect splicing]
EST ref. GenBank:   FE432796.1 [5' end]   FE498985.1 [3' end]
Cluster/Prediction ref. UniGene:   Smo.8080 [3' end]
Protein sequence: SmPrx41-2_71 (SmPrx41b_71)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   336 (310)
PWM (Da):   %s   35887.67 (33140.0) Transmb domain:   %s   o10-27i
PI (pH):   %s   10.39 (10.34) Peptide Signal:   %s   cut: 27 range:27-336
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASLLPSKRLLLLLFVIALLVLSGDAATKKKKVKKSKAKKVKAVTPAPSAGGMSLTFYNNKCSSFAKTVSDEVAAAMKKDPTIAAGLLRMHFHDCWVRGCDASVLLSGPNSERQAGPNLSLRGFQVIDTIKSKLERSCRGVVSCADILTQATRDAVVKAGGPSWDVPLGRKDGRVSSAAEVQLPAPSESTTSLISKFNAKQLSVSDLVALSGAHSFGFGNCGFFQSRITSRDPTLNSTYAQELQRKCQTSASVANDPITQNTLDNQYYKNLQQRKGLFTSDEGLFFHPQTKPLVDTFASNPAAFAQQFRASMAKLITLPPFQSNAGGIRTVCSIAK

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns). Incorrect prediction from JGI: prediction of exons 1 (short PS) and 2 of the SmPr41b, exon 3 of SmPrx40b and exon 4 of SmPrx39b. 4 ESTs (FE454280.1 and FE432795.1 ==>3'end).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCGCTGCTGCCATCCAAGAGGCTCTTGTTGCTACTTTTCGTCATCGCATTGCTGGTTTTGAGTGGTGATGCGGCCACCAAGAAGAAGAAGGTCAAGAAATCTAAAGCGAAGAAG
GTGAAAGCTGTTACGCCAGCTCCATCCGCCGGTGGTATGAGCCTCACGTTCTACAACAACAAATGTAGCTCTTTCGCCAAGACTGTCAGTGATGAAGTGGCTGCTGCCATGAAGAAGGAT
CCCACCATCGCTGCCGGGCTCTTGAGGATGCACTTCCACGACTGCTGGGTTCGA
GTAAGTTCCTCCTGTGGTTTTTAGTGATTCTCAACACGTACCTCGTAACTTGACAGGGATGCGATG
CTTCGGTTCTCCTCAGTGGCCCAAACTCGGAGAGGCAAGCCGGGCCAAACCTCTCGCTCCGTGGATTCCAAGTCATTGACACCATCAAGAGCAAGCTCGAGAGGTCGTGCCGCGGAGTCG
TCTCTTGCGCTGATATCTTGACACAAGCAACGCGGGACGCAGTTGTCAAG
GTAAGAAACTTTCTCAAATACTATTTTAGATTTAACCACTATACTTTAGGCTGGAGGCCCATCGTGGGAT
GTTCCACTGGGAAGGAAAGATGGACGAGTTTCCAGCGCTGCCGAGGTTCAGCTTCCTGCACCCTCCGAATCCACCACCTCATTGATCAGCAAATTCAATGCCAAGCAGCTCTCCGTCTCG
GACTTGGTGGCACTCTCAG
GTACTTCAAACTTCCTCTCGGATATCAGATGGTAACTTTGGATCTTGCTTGTGATCTCACAGGTGCTCACAGCTTTGGATTCGGAAACTGTGGCTTCTTCC
AGAGCAGGATCACGTCGCGAGACCCGACTCTCAACTCCACTTACGCGCAGGAGCTCCAGAGGAAATGCCAGACCAGTGCGTCGGTGGCCAACGATCCCATCACCCAGAACACGCTCGACA
ATCAGTACTACAAGAACCTCCAGCAGAGGAAGGGGCTCTTCACCTCGGACGAGGGGCTGTTCTTCCACCCCCAGACTAAACCGCTCGTCGATACCTTTGCATCCAACCCGGCAGCGTTCG
CCCAGCAGTTTAGAGCCTCGATGGCGAAGTTGATCACTCTGCCACCTTTTCAGTCCAACGCTGGTGGCATTCGAACCGTCTGCTCCATCGCCAAGTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCGCTGCTGCCATCCAAGAGGCTCTTGTTGCTACTTTTCGTCATCGCATTGCTGGTTTTGAGTGGTGATGCGGCCACCAAGAAGAAGAAGGTCAAGAAATCTAAAGCGAAGAAG
GTGAAAGCTGTTACGCCAGCTCCATCCGCCGGTGGTATGAGCCTCACGTTCTACAACAACAAATGTAGCTCTTTCGCCAAGACTGTCAGTGATGAAGTGGCTGCTGCCATGAAGAAGGAT
CCCACCATCGCTGCCGGGCTCTTGAGGATGCACTTCCACGACTGCTGGGTTCGA
GGATGCGATGCTTCGGTTCTCCTCAGTGGCCCAAACTCGGAGAGGCAAGCCGGGCCAAACCTCTCG
CTCCGTGGATTCCAAGTCATTGACACCATCAAGAGCAAGCTCGAGAGGTCGTGCCGCGGAGTCGTCTCTTGCGCTGATATCTTGACACAAGCAACGCGGGACGCAGTTGTCAAG
GCTGGA
GGCCCATCGTGGGATGTTCCACTGGGAAGGAAAGATGGACGAGTTTCCAGCGCTGCCGAGGTTCAGCTTCCTGCACCCTCCGAATCCACCACCTCATTGATCAGCAAATTCAATGCCAAG
CAGCTCTCCGTCTCGGACTTGGTGGCACTCTCAG
GTGCTCACAGCTTTGGATTCGGAAACTGTGGCTTCTTCCAGAGCAGGATCACGTCGCGAGACCCGACTCTCAACTCCACTTACGCG
CAGGAGCTCCAGAGGAAATGCCAGACCAGTGCGTCGGTGGCCAACGATCCCATCACCCAGAACACGCTCGACAATCAGTACTACAAGAACCTCCAGCAGAGGAAGGGGCTCTTCACCTCG
GACGAGGGGCTGTTCTTCCACCCCCAGACTAAACCGCTCGTCGATACCTTTGCATCCAACCCGGCAGCGTTCGCCCAGCAGTTTAGAGCCTCGATGGCGAAGTTGATCACTCTGCCACCT
TTTCAGTCCAACGCTGGTGGCATTCGAACCGTCTGCTCCATCGCCAAGTGA

Retrieve as FASTA