Entry information : PtPrx03 (POPTR_0001s05050 / PT01G01280 / Potri.001G013000)
Entry ID 7158
Creation 2010-01-15 (Christophe Dunand)
Last sequence changes 2010-08-02 (Christophe Dunand)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2012-03-07 (Qiang Li)
Peroxidase information: PtPrx03 (POPTR_0001s05050 / PT01G01280 / Potri.001G013000)
Name (synonym) PtPrx03 (POPTR_0001s05050 / PT01G01280 / Potri.001G013000)
Class Class III peroxidase    [Orthogroup: Prx004]
Taxonomy Eukaryota Viridiplantae Streptophyta Salicaceae Populus
Organism Populus trichocarpa (Western balsam poplar)    [TaxId: 3694 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PtPrx03
start..stop
S start..stop
PtPrx03_trichobel 699 0 1..343 1..343
PtPrx11_Trichobel 655 0 1..343 1..343
PnPrx01 637 0 1..343 1..343
PtPrx33 629 0 1..343 1..343
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 3892040..3892252 213 N° 2 3891759..3891950 192 N° 3 3891353..3891521 169 N° 4 3890808..3891262 455
complement(join(3890808..3891262,3891353..3891521,3891759..3891950,3892040..3892 252))


exon

Literature and cross-references PtPrx03 (POPTR_0001s05050 / PT01G01280 / Potri.001G013000)
DNA ref. Phytozome 12:   scaffold_1 (3892252..3890805)
Omic ref. ePlant:   Potri.001G013000
Protein sequence: PtPrx03 (POPTR_0001s05050 / PT01G01280 / Potri.001G013000)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   343 (321)
PWM (Da):   %s   36641.11 (34354.8) Transmb domain:   %s   i7-26o
PI (pH):   %s   4.36 (4.26) Peptide Signal:   %s   cut: 23 range:23-343
Sequence 384
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MHLSKAIVAAFFFVVLLGGTLAHGQLTPTFYDETCPNVSSIIRNVITETVVSDRRIGGSLIRLHFHDCFVNGCDGSLLLDNTDTIESEKEANGNNNSARGFEVVDRMKALLESACPTTVSCADILAIAAEESVFLAGGPNWTVPLGRRDSTTASRDAANASLPAPFLTLDQLRESFTNVGLNNNTDLVALSGAHTFGRAKCSTFNFRLYDFNGTGAPDPTLDPPFLEALQKLCPENGNGSVITDLDVTTADAFDNKYYSNLQGKRGLLQTDQELFSTPGADDVIALVNAFSANQTAFFESFVESMIRMGNISPLTGTEGEIRLNCRVVNANLAGPDSMLVSSI

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 1, 3 introns). no EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCATCTTTCTAAGGCTATAGTTGCAGCCTTTTTCTTTGTAGTTTTGCTTGGAGGAACATTGGCTCATGGCCAGCTTACTCCAACATTTTATGACGAGACATGTCCAAATGTGAGCAGC
ATTATCCGTAATGTCATTACGGAGACAGTGGTATCCGATCGTCGGATTGGAGGCAGCCTCATCAGGCTCCACTTCCATGACTGCTTTGTTAAT
GTAATTACTTTGAAACATCTTATATTT
GCTTAATTATATTAAACCGTCTATCTAAGTTGTGATTCTCAAGTTTTTTATTTTATTTTCAGGGCTGTGATGGTTCGCTTTTGTTGGACAATACTGATACTATAGAGAGCGAAAAGGAAG
CTAATGGGAACAACAACTCTGCAAGAGGTTTTGAAGTTGTTGATAGAATGAAGGCTTTGTTGGAGAGTGCCTGTCCTACTACTGTTTCCTGTGCTGATATACTCGCTATTGCAGCTGAAG
AATCCGTTTTTTTG
GTATCTTAAGATGATCCCTCAACCCCCCAAAATATAAAATAAATATCTTGCTGTCTAATTCTAGTCAAAGTACGAAGAACACAAATATCATAGTTTATCATAATTG
AATGAAAGAAAGAAGCTGAGATTTACTTAATTTTTTACACGACTTTATGAAGGTTTGGACAAAAAAGGAGTTAAGATAGAAATACGTTGAGAGTTGAAAAGTACTAATCCCCTAACTATG
CATGGTTGCAGGCAGGAGGTCCAAATTGGACAGTTCCATTAGGAAGAAGAGATAGTACAACAGCAAGCCGAGATGCAGCAAATGCTTCCCTTCCAGCCCCTTTTTTAACCCTTGATCAAC
TCAGAGAGAGCTTCACTAATGTCGGCCTTAATAATAATACTGATTTGGTAGCTCTATCTG
GTAAGTATTGTTTGTCAGGCTCGACTCTAAACTGTAAAACTCTGTTATAATTGATTCTCC
TTTGATGTAATTTCCTTTTTATCTTCTCAGGTGCTCACACATTTGGAAGGGCAAAATGTTCTACATTCAACTTCCGATTGTATGATTTCAATGGCACCGGTGCTCCTGACCCAACATTGG
ACCCGCCTTTTCTAGAAGCTCTTCAGAAATTATGTCCCGAAAATGGAAATGGGAGTGTGATAACAGATCTTGATGTCACAACAGCTGATGCCTTTGACAATAAGTACTACTCCAATCTGC
AAGGTAAGCGAGGCCTGCTTCAGACTGATCAAGAACTGTTTTCAACTCCCGGGGCAGATGATGTCATTGCACTTGTTAACGCTTTCAGTGCTAATCAAACAGCTTTCTTTGAAAGCTTTG
TGGAGTCCATGATAAGAATGGGAAATATCAGCCCTCTGACAGGAACTGAAGGGGAGATCAGATTGAACTGCAGGGTAGTCAATGCAAACCTGGCTGGGCCAGATAGCATGCTTGTTAGCT
CAAT

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCATCTTTCTAAGGCTATAGTTGCAGCCTTTTTCTTTGTAGTTTTGCTTGGAGGAACATTGGCTCATGGCCAGCTTACTCCAACATTTTATGACGAGACATGTCCAAATGTGAGCAGC
ATTATCCGTAATGTCATTACGGAGACAGTGGTATCCGATCGTCGGATTGGAGGCAGCCTCATCAGGCTCCACTTCCATGACTGCTTTGTTAAT
GGCTGTGATGGTTCGCTTTTGTTGGAC
AATACTGATACTATAGAGAGCGAAAAGGAAGCTAATGGGAACAACAACTCTGCAAGAGGTTTTGAAGTTGTTGATAGAATGAAGGCTTTGTTGGAGAGTGCCTGTCCTACTACTGTTTCC
TGTGCTGATATACTCGCTATTGCAGCTGAAGAATCCGTTTTTTTG
GCAGGAGGTCCAAATTGGACAGTTCCATTAGGAAGAAGAGATAGTACAACAGCAAGCCGAGATGCAGCAAATGCT
TCCCTTCCAGCCCCTTTTTTAACCCTTGATCAACTCAGAGAGAGCTTCACTAATGTCGGCCTTAATAATAATACTGATTTGGTAGCTCTATCTG
GTGCTCACACATTTGGAAGGGCAAAA
TGTTCTACATTCAACTTCCGATTGTATGATTTCAATGGCACCGGTGCTCCTGACCCAACATTGGACCCGCCTTTTCTAGAAGCTCTTCAGAAATTATGTCCCGAAAATGGAAATGGGAGT
GTGATAACAGATCTTGATGTCACAACAGCTGATGCCTTTGACAATAAGTACTACTCCAATCTGCAAGGTAAGCGAGGCCTGCTTCAGACTGATCAAGAACTGTTTTCAACTCCCGGGGCA
GATGATGTCATTGCACTTGTTAACGCTTTCAGTGCTAATCAAACAGCTTTCTTTGAAAGCTTTGTGGAGTCCATGATAAGAATGGGAAATATCAGCCCTCTGACAGGAACTGAAGGGGAG
ATCAGATTGAACTGCAGGGTAGTCAATGCAAACCTGGCTGGGCCAGATAGCATGCTTGTTAGCTCAAT

Retrieve as FASTA