Entry information : SmKat03-2_26 (SmKat03b_26)
Entry ID 7281
Creation 2010-03-04 (Christophe Dunand)
Last sequence changes 2010-03-04 (Christophe Dunand)
Sequence status complete
Reviewer Marcel Zamocky
Last annotation changes 2011-01-25 (Toky Ramarohetra (Scipio))
Peroxidase information: SmKat03-2_26 (SmKat03b_26)
Name (synonym) SmKat03-2_26 (SmKat03b_26)
Class Catalase    [Orthogroup: Kat001]
Taxonomy Eukaryota Viridiplantae Streptophyta Isoetopsida Selaginellaceae Selaginella
Organism Selaginella moellendorffii    [TaxId: 88036 ]
Cellular localisation N/D
Tissue type N/D
Inducer Abiotic stress
Repressor N/D
Best BLASTp hits
Perox score E-value SmKat03-2_26
start..stop
S start..stop
SmKat03-1_34 1065 0 1..517 1..517
MpKat02 781 0 9..517 80..601
MpalKat02 779 0 20..517 106..604
PpaKat05 764 0 14..517 8..513
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 821334..821461 128 N° 2 821092..821235 144 N° 3 820713..821031 319 N° 4 820339..820656 318
N° 5 820073..820285 213 N° 6 819853..820010 158 N° 7 819510..819783 274  
complement(join(819510..819783,819853..820010,820073..820285,820339..820656,8207 13..821031,821092..821235,821334..821461))


exon

Literature and cross-references SmKat03-2_26 (SmKat03b_26)
DNA ref. Phytozome 12:   scaffold_26 (821461..819510)
mRNA ref. JGI transcript:   102601
EST ref. GenBank:   FE497496.1 [5' end]
Cluster/Prediction ref. UniGene:   Smo.1573
Protein sequence: SmKat03-2_26 (SmKat03b_26)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   517
PWM (Da):   %s   58514.13  
PI (pH):   %s   7.04
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MDAESGSKASNGNSKSASVRVGSSGKPLHTTLAGAPVSDDNNSVTVGQSGHLLFEDVHLFEKQARLNRERVPERFVHAKGAGAHGYFEVTKDVSNLCKAKFLSEPGKRTPVFARFSSVAAERGFTDLARDVRGFAVKFYTEEGNWDMTGNNTPVFWVRDPLKFPDFVHSQKRNPKTNAKDPNAFWDFLSLVPESMHLLITFSPRGVPATYRNMNGYGSHTFKWVNKERKAHWVKFHLVTEHGIKNLTHEEAVSLSGSKPDYATEDLLTSIEEGNFPAWKFYVQVMPLEDAPKYKWDPFDLTKVWLHKDYPLMEVGRLVLDRNVENYHAEVEQAAFSPGSFVPGIEASPDRILQSRLFAYDDAARYRIGTNFHDVPINKPIVKVQTYSRDGAMVVSDNGGSKPNYYPNSYDNLPQNDPTQPDVHPYEHEGGTVGRFPPRKWEEQDDYEQPRMLWKLMSEEDKEQTVSNIANHIRGAAEFIQERQMGLFRKCDGDLASRIEKKLAEKKKSPEPYTMIA

Retrieve as FASTA  
Remarks Complete sequence from genomic (6 introns) and 38 ESTs. Unigene compiles ESTs from both alleles.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGACGCCGAGAGTGGATCCAAGGCCTCGAATGGCAACAGCAAGAGCGCTAGCGTGCGAGTTGGAAGCTCGGGCAAGCCTCTCCACACCACCCTCGCCGGAGCTCCAGTCTCGGACGAT
AACAACAG
GTACTGTGGTTCTTCCCAAAGCTTGGATTCGATCAAAAGCTTTGGTTTTTTTTGTCTTGATTCGATCGAAAGCTTTGTTTTTCTTTGTTTTCCTCTAGTGTGACTGTAGGAC
AGAGTGGACACCTTTTGTTTGAAGACGTCCATTTGTTTGAGAAGCAAGCACGGCTCAACCGTGAGAGAGTTCCCGAGCGCTTCGTCCATGCCAAAGGTGCCGGAGCTCATGGATACTTCG
AAGTTACAAA
GTAAGTCTGCTACTCGGCTCGCTTGTTTCTTTTACGTTTCGGACTCCGTGCCATTTGTAGGGACGTATCAAACTTGTGCAAGGCAAAGTTCTTGAGCGAGCCCGGAAAGA
GGACCCCCGTTTTCGCCAGGTTCTCGAGCGTGGCGGCCGAGCGTGGATTCACCGACCTTGCGCGAGATGTCCGAGGCTTCGCGGTTAAGTTTTACACCGAGGAGGGGAACTGGGACATGA
CCGGGAATAACACGCCAGTTTTCTGGGTCCGGGACCCTCTCAAGTTTCCCGACTTTGTCCACTCGCAAAAGAGGAACCCCAAGACCAACGCCAAAGATCCAAACGCGTTCTGGGATTTTC
TGAGCTTGGTTCCCGAGTCCATGCATCAG
GTAACTTATAACTCTTTGCGTAACTTTGATCAACTTTGTCGATTCTCCTTGTGAAGCTTTTGATCACATTCTCGCCTCGAGGAGTGCCGGC
TACATATAGAAACATGAACGGATACGGCTCGCATACTTTCAAGTGGGTCAACAAGGAGAGGAAAGCTCACTGGGTGAAGTTCCATCTCGTCACGGAGCACGGCATCAAAAACTTGACCCA
CGAAGAGGCCGTGAGTCTCTCGGGGTCTAAACCAGACTATGCGACCGAGGATCTCTTGACTAGCATAGAGGAAGGGAACTTCCCGGCCTGGAAGTTCTACGTCCAAGTTATGCCGCTGGA
GGACGCTCCAAAGTATAAGTGGGATCCTTTCGACTTGACAAAG
GTATGTGACACAATTTTTCTTCTTCTTCTGTTTTTCAAGGACGTGGATTTCAGGTGTGGTTGCACAAGGATTATCCC
CTCATGGAAGTTGGCAGGCTCGTTCTCGATAGAAATGTCGAAAACTATCACGCGGAAGTGGAGCAAGCGGCATTCTCTCCAGGAAGCTTTGTTCCTGGGATTGAGGCTTCCCCGGACCGT
ATACTCCAGTCCCGGCTCTTTGCTTACGACGACGCTGCTCGATACAGAATTGGGACAAACTTCCACGAC
GTAAGAATTTATAATTTTCCAAAGATTCTAAATGTGATCTGATTGTGTCTA
CCACCATCCAGGTTCCGATCAACAAACCCATTGTGAAAGTCCAGACATATTCTCGAGATGGAGCGATGGTTGTCTCGGACAACGGCGGCAGCAAACCCAATTACTATCCGAACTCGTACG
ACAACTTGCCTCAAAACGACCCGACTCAGCCGGATGTTCACCCGTACGA
GTAAGCAAAGCTTTTGTTTCCTATCACCGAGAAGGAGCTTCTAACATTCCTTTTCCTTCTTCTACGCAGGC
ATGAAGGTGGAACAGTTGGCCGGTTCCCTCCAAGAAAATGGGAAGAGCAGGACGACTACGAGCAGCCCCGTATGCTCTGGAAACTCATGTCCGAGGAAGACAAGGAGCAAACCGTGTCAA
ACATTGCAAACCACATCCGCGGAGCCGCCGAGTTCATCCAAGAGCGTCAAATGGGTCTCTTCCGGAAATGCGACGGGGATCTCGCGTCCAGGATCGAGAAGAAGCTCGCGGAGAAGAAGA
AGTCGCCGGAGCCGTATACCATGATCGCCTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGACGCCGAGAGTGGATCCAAGGCCTCGAATGGCAACAGCAAGAGCGCTAGCGTGCGAGTTGGAAGCTCGGGCAAGCCTCTCCACACCACCCTCGCCGGAGCTCCAGTCTCGGACGAT
AACAACAG
TGTGACTGTAGGACAGAGTGGACACCTTTTGTTTGAAGACGTCCATTTGTTTGAGAAGCAAGCACGGCTCAACCGTGAGAGAGTTCCCGAGCGCTTCGTCCATGCCAAAGGT
GCCGGAGCTCATGGATACTTCGAAGTTACAAA
GGACGTATCAAACTTGTGCAAGGCAAAGTTCTTGAGCGAGCCCGGAAAGAGGACCCCCGTTTTCGCCAGGTTCTCGAGCGTGGCGGCC
GAGCGTGGATTCACCGACCTTGCGCGAGATGTCCGAGGCTTCGCGGTTAAGTTTTACACCGAGGAGGGGAACTGGGACATGACCGGGAATAACACGCCAGTTTTCTGGGTCCGGGACCCT
CTCAAGTTTCCCGACTTTGTCCACTCGCAAAAGAGGAACCCCAAGACCAACGCCAAAGATCCAAACGCGTTCTGGGATTTTCTGAGCTTGGTTCCCGAGTCCATGCATCAG
CTTTTGATC
ACATTCTCGCCTCGAGGAGTGCCGGCTACATATAGAAACATGAACGGATACGGCTCGCATACTTTCAAGTGGGTCAACAAGGAGAGGAAAGCTCACTGGGTGAAGTTCCATCTCGTCACG
GAGCACGGCATCAAAAACTTGACCCACGAAGAGGCCGTGAGTCTCTCGGGGTCTAAACCAGACTATGCGACCGAGGATCTCTTGACTAGCATAGAGGAAGGGAACTTCCCGGCCTGGAAG
TTCTACGTCCAAGTTATGCCGCTGGAGGACGCTCCAAAGTATAAGTGGGATCCTTTCGACTTGACAAAG
GTGTGGTTGCACAAGGATTATCCCCTCATGGAAGTTGGCAGGCTCGTTCTC
GATAGAAATGTCGAAAACTATCACGCGGAAGTGGAGCAAGCGGCATTCTCTCCAGGAAGCTTTGTTCCTGGGATTGAGGCTTCCCCGGACCGTATACTCCAGTCCCGGCTCTTTGCTTAC
GACGACGCTGCTCGATACAGAATTGGGACAAACTTCCACGAC
GTTCCGATCAACAAACCCATTGTGAAAGTCCAGACATATTCTCGAGATGGAGCGATGGTTGTCTCGGACAACGGCGGC
AGCAAACCCAATTACTATCCGAACTCGTACGACAACTTGCCTCAAAACGACCCGACTCAGCCGGATGTTCACCCGTACGA
GCATGAAGGTGGAACAGTTGGCCGGTTCCCTCCAAGAAAA
TGGGAAGAGCAGGACGACTACGAGCAGCCCCGTATGCTCTGGAAACTCATGTCCGAGGAAGACAAGGAGCAAACCGTGTCAAACATTGCAAACCACATCCGCGGAGCCGCCGAGTTCATC
CAAGAGCGTCAAATGGGTCTCTTCCGGAAATGCGACGGGGATCTCGCGTCCAGGATCGAGAAGAAGCTCGCGGAGAAGAAGAAGTCGCCGGAGCCGTATACCATGATCGCCTAG

Retrieve as FASTA