Entry information : ZmPrx33
Entry ID 729
Creation 2005-12-15 (Christophe Dunand)
Last sequence changes 2005-12-15 (Christophe Dunand)
Sequence status complete
Reviewer reviewer name not stored
Last annotation changes 2010-12-23 (Marie Brette (Scipio))
Peroxidase information: ZmPrx33
Name ZmPrx33
Class Class III peroxidase    [Orthogroup: Prx034]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Zea
Organism Zea mays    [TaxId: 4577 ]
Cellular localisation N/D
Tissue types Endosperm
Mixed tissues
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value ZmPrx33
start..stop
S start..stop
SbPrx117 587 0 4..338 5..338
OsPrx73 365 6e-127 42..338 10..308
AtrPrx19 313 6e-107 40..337 6..303
GmPrx166 305 2e-103 40..337 27..327
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 110686851..110687111 261 N° 2 110687215..110687578 364 N° 3 110687681..110688072 392  
join(110686851..110687111,110687215..110687578,110687681..110688072)


exon

Literature and cross-references ZmPrx33
Literature Walbot,V., unpublished
DNA ref. GenBank:   AC196291 (123316..124534)
Cluster/Prediction ref. UniGene:   Zm.19338
Protein sequence: ZmPrx33
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   338 (302)
PWM (Da):   %s   35577.16 (32073.3) Transmb domain:   %s   i9-31o
PI (pH):   %s   6.72 (6.50) Peptide Signal:   %s   cut: 37 range:37-338
Sequence 379
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGASGGEKLGTLVCVLAHVSLLLVLVLAPCVCKATGGDYGGLSNDHYTESCPELETIVKKSLAPIFAVDITSPAALLRLLFHDCQVHGCDGSILLNSDERRHITSELGSRKNLGIRHVGTVGLVKAAVEAACPGRVSCADIVVLAAREAVAHTGGPRVASVPLGRRDATTTSTQAADAQLPSCFLGIDGALDIFTSRGMTVEETVAILGSHTLGGGHCVNIDTGRARRDKAFEALLHLQCPKTMPPLITEAVVFVPSDLTPTWFDTHYYRGAAAGRGLFNVDDEASTYARTAGYVRRFAEDREGFFGVFASAFVKLSGFGVLTGEQGEIRKKCDVVNY

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 8, intron 1 and 3) and 92 ESTs. Also found in AC201782.4
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGGGCGCGTCTGGTGGTGAAAAGCTTGGTACTCTTGTGTGTGTTCTTGCACATGTATCGTTATTATTGGTGCTCGTGCTAGCACCGTGTGTGTGCAAGGCGACTGGTGGTGACTACGGCG
GCCTCTCCAACGACCACTACACCGAGTCCTGCCCGGAGCTGGAGACCATCGTCAAGAAGTCCCTGGCGCCGATCTTCGCCGTGGACATCACCTCGCCGGCCGCCCTCCTCCGCCTGCTCT
TCCACGACTGCCAAGTCCAC
GTACGTACGCACGCACGCACGTAGTACGCCTAGCTTGTTTGGATGTCAGTGTTATATATATCGATCGTTGCTGTGTGCGTGCGGCGCGCGCAACCGGCTG
CAGGGATGTGACGGCTCCATATTGCTCAACTCCGACGAGCGCCGGCACATAACCTCGGAACTGGGCTCACGCAAGAACCTCGGGATCCGGCACGTCGGCACCGTCGGGCTCGTGAAGGCG
GCCGTGGAAGCGGCCTGCCCTGGCCGGGTCTCCTGCGCCGACATCGTCGTCCTGGCGGCGAGGGAGGCCGTGGCGCACACCGGCGGCCCGCGCGTCGCCAGCGTGCCCCTTGGCCGGAGG
GACGCCACGACCACCAGCACGCAGGCCGCCGATGCGCAGCTTCCGTCCTGTTTCCTCGGGATTGACGGCGCGCTCGACATCTTTACCAGCCGCGGCATGACCGTCGAGGAGACAGTCGCC
ATTCTAG
GTTTGATTTCGTACAATGCCAAATAAAAAAAATTGTTCTAACATTCGTCACTACTCATGCACGGTGTCTGATCGTTCTTCATATATATCCATTCATATGCAGGGAGCCACACG
CTGGGGGGTGGCCATTGCGTCAACATAGACACCGGTCGCGCGCGACGCGACAAGGCATTTGAGGCCCTGCTGCACCTGCAGTGCCCAAAGACCATGCCGCCTCTGATCACAGAGGCCGTC
GTCTTTGTACCCAGCGACCTGACGCCGACATGGTTCGACACCCACTACTACCGGGGCGCCGCCGCAGGCCGGGGGCTCTTCAACGTCGACGACGAGGCCTCCACCTACGCGCGCACGGCG
GGGTACGTGCGGCGGTTCGCTGAGGACAGGGAGGGCTTCTTCGGGGTCTTCGCCTCGGCCTTCGTCAAGCTCTCTGGGTTTGGCGTGCTCACCGGTGAGCAGGGTGAGATCAGGAAGAAA
TGCGACGTCGTTAACTACTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGGGCGCGTCTGGTGGTGAAAAGCTTGGTACTCTTGTGTGTGTTCTTGCACATGTATCGTTATTATTGGTGCTCGTGCTAGCACCGTGTGTGTGCAAGGCGACTGGTGGTGACTACGGCG
GCCTCTCCAACGACCACTACACCGAGTCCTGCCCGGAGCTGGAGACCATCGTCAAGAAGTCCCTGGCGCCGATCTTCGCCGTGGACATCACCTCGCCGGCCGCCCTCCTCCGCCTGCTCT
TCCACGACTGCCAAGTCCAC
GGATGTGACGGCTCCATATTGCTCAACTCCGACGAGCGCCGGCACATAACCTCGGAACTGGGCTCACGCAAGAACCTCGGGATCCGGCACGTCGGCACCG
TCGGGCTCGTGAAGGCGGCCGTGGAAGCGGCCTGCCCTGGCCGGGTCTCCTGCGCCGACATCGTCGTCCTGGCGGCGAGGGAGGCCGTGGCGCACACCGGCGGCCCGCGCGTCGCCAGCG
TGCCCCTTGGCCGGAGGGACGCCACGACCACCAGCACGCAGGCCGCCGATGCGCAGCTTCCGTCCTGTTTCCTCGGGATTGACGGCGCGCTCGACATCTTTACCAGCCGCGGCATGACCG
TCGAGGAGACAGTCGCCATTCTAG
GGAGCCACACGCTGGGGGGTGGCCATTGCGTCAACATAGACACCGGTCGCGCGCGACGCGACAAGGCATTTGAGGCCCTGCTGCACCTGCAGTGCC
CAAAGACCATGCCGCCTCTGATCACAGAGGCCGTCGTCTTTGTACCCAGCGACCTGACGCCGACATGGTTCGACACCCACTACTACCGGGGCGCCGCCGCAGGCCGGGGGCTCTTCAACG
TCGACGACGAGGCCTCCACCTACGCGCGCACGGCGGGGTACGTGCGGCGGTTCGCTGAGGACAGGGAGGGCTTCTTCGGGGTCTTCGCCTCGGCCTTCGTCAAGCTCTCTGGGTTTGGCG
TGCTCACCGGTGAGCAGGGTGAGATCAGGAAGAAATGCGACGTCGTTAACTACTGA

Retrieve as FASTA