Entry information : ZmPrx50 (peroxidase 45)
Entry ID 746
Creation 2009-01-10 (Christophe Dunand)
Last sequence changes 2010-12-23 (Marie Brette (Scipio))
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2010-12-28 (Christophe Dunand)
Peroxidase information: ZmPrx50 (peroxidase 45)
Name (synonym) ZmPrx50 (peroxidase 45)
Class Class III peroxidase    [Orthogroup: Prx113]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Zea
Organism Zea mays    [TaxId: 4577 ]
Cellular localisation N/D
Tissue type Mixed tissues
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value ZmPrx50
start..stop
S start..stop
SbPrx142 575 0 1..317 1..318
SiPrx35 511 0 1..317 1..319
SiPrx36 493 1e-177 1..317 1..318
SbPrx141 490 1e-176 18..317 21..320
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 53376322..53376540 219 N° 2 53376623..53376820 198 N° 3 53376968..53377127 160 N° 4 53377239..53377615 377
join(53376322..53376540,53376623..53376820,53376968..53377127,53377239..53377615 )


exon

Literature and cross-references ZmPrx50 (peroxidase 45)
Protein ref. UniProtKB:   B6SU07 [Other strain]
DNA ref. GenBank:   AC210686.2 (59184..60474)
mRNA ref. GenBank:   EU956222 [Other strain]
Cluster/Prediction ref. UniGene:   Zm.130401
Protein sequence: ZmPrx50 (peroxidase 45)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   317 (292)
PWM (Da):   %s   33861.74 (31501.4)  
PI (pH):   %s   5.82 (5.82) Peptide Signal:   %s   cut: 26 range:26-317
Sequence 358
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASLGLVLLVAVVVSAALMPPSAVAQQLTPDYYASTCPNLEAIVRRSVQQSMVQSQIAAPAALRLFFHDCAVMGCDASIMIVNSNGDDEWRNTANQSLKPEGFQAILSAKAAVDSNQQCQYKVSCADIMALVAREAVFLSGGPYYQVELGRFDGRVSTRDSVRLPSVNFTLDQLNAFFSGLGFSQNEMVALLGAHTLGAADCPFFQYRIGDPSMDPSLASQLRGTCGSNPSGGFAFFDPSPVRFDNAFYRNLQGGRGLLGTDQVLYSDQRSRSAVDSYASNQGAFFTDFVAAITKLGRIGAKTAATGEIRRVCNFPN

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 5, 3 introns) and 6 ESTs. Also found in AC201748.4. The both contigs contain a second Prx.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGGCGAGCCTTGGGCTGGTCCTGCTTGTCGCCGTCGTCGTGTCCGCGGCGCTCATGCCACCGTCCGCCGTCGCGCAGCAGCTGACGCCGGACTACTACGCCAGCACCTGCCCCAACCTCG
AGGCCATCGTCCGGCGCTCCGTCCAGCAGTCCATGGTGCAGTCCCAGATCGCCGCGCCCGCCGCGCTCAGGCTCTTCTTCCACGACTGCGCCGTCATG
GTACGTGCGCTAACGCTACGCA
CGTACGGGCACGTACGCACAGCCAACCCAGTCGCTCAATGGTGCACGCGCGCGGATGCAGGGCTGCGACGCGTCGATCATGATCGTCAACTCGAACGGCGACGACGAGTGGCGGAACACC
GCCAACCAGTCGCTCAAGCCGGAAGGGTTCCAGGCCATTCTCAGCGCCAAGGCCGCCGTGGACAGCAACCAGCAGTGCCAGTACAAGGTGTCGTGCGCGGACATCATGGCCCTCGTCGCC
AGAGAAGCCGTCTTCCTG
GTATGTATGCATGTATAATCGTCAGCCTCCATGCCGTCAGTCGTTGCTGCTTGGTTCAAAAAGAATGGAATCTTGTAGTCAGTTGCATTGCATACATGCTGT
GCACGCAACTAACTCTAAACACTCTGCTTGCACCGCCGGTTGCAGAGTGGCGGGCCGTACTACCAGGTGGAGCTCGGCCGGTTCGACGGCAGGGTGTCGACTAGGGACAGCGTCCGGCTG
CCGAGTGTCAACTTCACCCTGGACCAGCTCAACGCCTTCTTCTCCGGCCTCGGCTTCTCCCAGAACGAAATGGTCGCCCTCTTAG
GTAAGCCGCCGGCTGCTCATCCCATCCATCATGGT
CTCTTGTAATTGCCAGCCCGCTGAGTGCTATGCTGACCTTTGCACGCCGGCCCGGCCGCCGATTCGATTCGACCAGGCGCGCACACCCTCGGCGCGGCGGACTGCCCTTTCTTCCAGTAC
AGGATCGGCGACCCGAGCATGGACCCGAGCCTCGCGTCCCAGCTGCGCGGCACCTGCGGCTCCAACCCCAGCGGTGGCTTCGCGTTCTTCGACCCCTCGCCGGTGAGGTTCGACAACGCC
TTCTACCGGAACCTGCAAGGAGGCAGGGGGCTCCTGGGCACCGACCAGGTGCTGTACAGCGATCAGAGATCACGCAGCGCGGTCGACTCCTACGCGTCCAACCAGGGCGCCTTCTTCACC
GACTTCGTGGCGGCGATCACCAAGCTCGGGAGGATCGGGGCCAAGACGGCGGCTACTGGTGAGATACGCCGCGTCTGCAACTTCCCAAACTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGGCGAGCCTTGGGCTGGTCCTGCTTGTCGCCGTCGTCGTGTCCGCGGCGCTCATGCCACCGTCCGCCGTCGCGCAGCAGCTGACGCCGGACTACTACGCCAGCACCTGCCCCAACCTCG
AGGCCATCGTCCGGCGCTCCGTCCAGCAGTCCATGGTGCAGTCCCAGATCGCCGCGCCCGCCGCGCTCAGGCTCTTCTTCCACGACTGCGCCGTCATG
GGCTGCGACGCGTCGATCATGA
TCGTCAACTCGAACGGCGACGACGAGTGGCGGAACACCGCCAACCAGTCGCTCAAGCCGGAAGGGTTCCAGGCCATTCTCAGCGCCAAGGCCGCCGTGGACAGCAACCAGCAGTGCCAGT
ACAAGGTGTCGTGCGCGGACATCATGGCCCTCGTCGCCAGAGAAGCCGTCTTCCTG
AGTGGCGGGCCGTACTACCAGGTGGAGCTCGGCCGGTTCGACGGCAGGGTGTCGACTAGGGACA
GCGTCCGGCTGCCGAGTGTCAACTTCACCCTGGACCAGCTCAACGCCTTCTTCTCCGGCCTCGGCTTCTCCCAGAACGAAATGGTCGCCCTCTTAG
GCGCGCACACCCTCGGCGCGGCGG
ACTGCCCTTTCTTCCAGTACAGGATCGGCGACCCGAGCATGGACCCGAGCCTCGCGTCCCAGCTGCGCGGCACCTGCGGCTCCAACCCCAGCGGTGGCTTCGCGTTCTTCGACCCCTCGC
CGGTGAGGTTCGACAACGCCTTCTACCGGAACCTGCAAGGAGGCAGGGGGCTCCTGGGCACCGACCAGGTGCTGTACAGCGATCAGAGATCACGCAGCGCGGTCGACTCCTACGCGTCCA
ACCAGGGCGCCTTCTTCACCGACTTCGTGGCGGCGATCACCAAGCTCGGGAGGATCGGGGCCAAGACGGCGGCTACTGGTGAGATACGCCGCGTCTGCAACTTCCCAAACTAG

Retrieve as FASTA