Entry information : AlyKat01
Entry ID 7465
Creation 2010-08-10 (Christophe Dunand)
Last sequence changes 2010-08-10 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2010-12-24 (Marie Brette (Scipio))
Peroxidase information: AlyKat01
Name AlyKat01
Class Catalase    [Orthogroup: Kat001]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Arabidopsis
Organism Arabidopsis lyrata    [TaxId: 59689 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AlyKat01
start..stop
S start..stop
AtKat01 1020 0 1..492 1..492
ThasKat01 946 0 1..492 1..492
BnKat02_other 940 0 1..492 1..492
NtKat03-1B 926 0 1..492 1..492
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 8820698..8820712 15 N° 2 8821311..8821407 97 N° 3 8821678..8821955 278 N° 4 8822131..8822907 777
N° 5 8823004..8823093 90 N° 6 8823174..8823241 68 N° 7 8823352..8823505 154  
join(8820698..8820712,8821311..8821407,8821678..8821955,8822131..8822907,8823004 ..8823093,8823174..8823241,8823352..8823505)


exon

Literature and cross-references AlyKat01
DNA ref. Phytozome 12:   scaffold_1 (8820698..8823505)
Protein sequence: AlyKat01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   492
PWM (Da):   %s   56630.21  
PI (pH):   %s   7.3
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MDPYRVRPSSAHDSPFFTTNSGAPVWNNNSSLTVGTRGPILLEDYHLLEKLANFDRERIPERVVHARGASAKGFFEVTHDITQLTSADFLRGPGAQTPVIVRFSTVIHERGSPETLRDPRGFAVKFYTRGNFDLVGNNFPVFFVRDGMKFPDMVHALKPNPKSHIQENWRILDFFSHHPESLHMFSFLFDDLGIPQDYRHMEGAGVNTYMLINKAGKAHYVKFHWKPTCGIKCLSDEEAIRVGGSNHSHATKDLYDSIAAGNYPQWNLFVQVMDPAHEDKFDFDPLDVTKIWPEDILPLQPVGRLVLNKNIDNFFNEYEQIAFCPALVVPGIHYSDDKLLQTRIFSYADSQRHRLGPNYLQLPVNAPKCAHHNNHHDGFMNFMHRDEEVNYFPSRLDPVRHAEKYPTTPIVCTGNREKCFIGKENNFQQPGERYRSWDSDRQERFVKRFVEALSEPRVTHEIRSIWISYWSQADKSLGQKLATRLNVRPNF

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 1, 6 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGATCCATACAGGGTACATCGATCGATTCTCTTTAGGCTCCTTTTTTTGTAATCTGAAATTTTGCCTTACTTGATTTCGTATCAATTTGGTTTTTGATTTGGTGTTGAATACTACAAA
GTATACGATCTCTCTCGGTTAAAATGATATGCAAAATTGGGGTGATTGTTCGACCTATTGAGGTTTTTGTGGGGTCTTTAACTCAATTTCTTTAATATTTAGCAGAGATCAGGTTTGGGA
TTTACATGCGTTGAATATTAGAAAAGAAAACTGGTACATATTTAGGATTCTACATGTTTTCTTCGTCTATTGATTGTTTAATCAAACAAGTCTTAAGGCTCATGTTTTAAGGTTTCTTTA
TCACTGTGTTTGATTGTGAATATCATTGTACCTTAAATATCAGCTCGGAAATGCTAACGTTTTCGTGATTTGTATCTTACTTTTTGTTTAGTTGAATTTTAAGTTAAATGGATCATATAC
TTTGTGGCATTGTTATCTATCTAGTTACAAGTATCTCATTTGTCAAAGACGTTTCTCCATTTTAAGGGAATTTGGTTAAATTTTTTGATCCAGTTGCATTTTTTATTCTTCTGAATTTAT
TTGTTGACTGCAGGTTCGTCCTTCAAGCGCTCATGATTCCCCTTTCTTCACTACAAACTCGGGTGCTCCTGTCTGGAACAACAACTCTTCTTTGACTGTCGGAACTCGAGGTGCGTCTCT
CTTTCTTTATCTCTCGAATACAAATTATAGCAAATAGGTTGAACCAGTGGTTGTCAGAGATGTCCTTAAAGCTAGAGTAATGGAAGCCAAATAATTTTTATAAACGTTTAGATAAGAATG
TCATTAGTGTTTTTCTGGACTTGCGTGAATCAGCTCTCTTCCTTCATTTATATGCCAAATCTATTAATTCTTCCAATGTTTATTCTGTTTGCTTTCTTGAAAATTTAGAAATGTGAAACG
ATGATATTGTATACTGTCAGGTCCAATTCTTCTGGAGGACTATCATCTGCTTGAGAAACTCGCCAACTTTGACAGGGAGCGGATTCCTGAGAGGGTAGTTCATGCCAGGGGAGCCAGTGC
TAAGGGTTTCTTTGAAGTCACTCATGACATTACACAACTTACTTCTGCTGATTTTCTTCGAGGACCTGGTGCTCAGACTCCTGTTATTGTTCGTTTCTCAACTGTCATCCATGAGCGTGG
CAGTCCCGAGACTCTCAGAGATCCTCGTGGTTTTGCTGTTAAGTTTTACACCAGAGAG
GTTAGCTTTTGTCTTATCCTTCCATCGTCTCTCTGTTTTCTGTAATCAATATCTATGTGTTT
GCTGTTGTTGGAATGTTTTATTTGCTCATCTATTTCGTTTTACCACCTATTTGATTAATTGCTAATCATATTGTACTCTTCTGATTCTTATTACCCTCTGTTTGCAAACTCAGGGGAACT
TTGATCTTGTTGGGAACAACTTCCCTGTATTCTTCGTCCGTGATGGAATGAAATTCCCTGACATGGTCCATGCATTGAAACCGAATCCCAAGTCCCACATTCAGGAGAACTGGAGAATAC
TGGACTTCTTCTCCCACCACCCAGAGAGTTTGCACATGTTTTCGTTCCTCTTTGATGATCTCGGTATCCCACAGGACTACAGGCACATGGAAGGTGCTGGGGTCAACACTTACATGCTAA
TCAACAAAGCTGGAAAAGCTCACTATGTGAAATTCCACTGGAAGCCGACTTGTGGGATCAAATGCCTGTCGGATGAGGAAGCTATCAGAGTTGGAGGATCCAATCACAGCCATGCTACTA
AAGATCTCTATGACTCGATCGCAGCCGGGAACTATCCACAGTGGAATCTCTTCGTTCAGGTGATGGATCCTGCCCACGAAGACAAATTCGATTTCGATCCGCTTGATGTCACAAAGATCT
GGCCTGAAGATATCTTGCCTCTACAACCTGTTGGCCGCTTGGTCTTGAACAAAAACATCGACAACTTCTTTAACGAGTACGAACAGATTGCTTTCTGTCCTGCTCTTGTGGTTCCAGGCA
TCCACTATTCAGATGATAAACTACTCCAGACCCGGATCTTCTCCTACGCTGATAGTCAGAGACACCGTCTTGGACCAAACTATCTGCAACTACCTGTCAATGCCCCTAAATGTGCTCACC
ACAACAATCACCATGATGGTTTTATGAACTTCATGCACAGGGATGAGGAG
GTAATAATCTCTCTCGGCTCTGGAAACTCTCAGATACTTAAATTCACCACCATTTTCACATTTATATGAA
GTAAATTTGTTACTTTCCAATTCCAGGTCAATTACTTCCCTTCAAGGTTGGATCCAGTTCGCCATGCCGAAAAATACCCTACAACTCCTATAGTCTGCACTGGAAATCGTGAGAAGGTCA
GATTCCTCTACATGCCTTAATATTGATCACAAGTTTTTCCACGTAGTTAAACTCAAATGTCATCGTTATATCACAGTGCTTCATTGGGAAGGAGAACAACTTCCAGCAACCAGGGGAGAG
ATACCGTTCCTGGGATTCAGACAG
GTAAACACTATAAATAAACTCAGAAACCACTTTGCAAAATCAACAATTCTTACACATGAACCACAAATGTCATAATTCATTCTAATTTTCTTTTGT
CTGGTACCCAATAGGCAAGAGCGGTTCGTAAAGCGTTTTGTTGAAGCGCTTTCGGAGCCTCGTGTCACGCACGAAATCCGCAGCATTTGGATCTCTTACTGGTCTCAGGCAGACAAATCA
CTGGGACAGAAACTAGCGACTCGTCTTAACGTGAGGCCAAACTTCTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGATCCATACAGGGTTCGTCCTTCAAGCGCTCATGATTCCCCTTTCTTCACTACAAACTCGGGTGCTCCTGTCTGGAACAACAACTCTTCTTTGACTGTCGGAACTCGAGGTCCAATT
CTTCTGGAGGACTATCATCTGCTTGAGAAACTCGCCAACTTTGACAGGGAGCGGATTCCTGAGAGGGTAGTTCATGCCAGGGGAGCCAGTGCTAAGGGTTTCTTTGAAGTCACTCATGAC
ATTACACAACTTACTTCTGCTGATTTTCTTCGAGGACCTGGTGCTCAGACTCCTGTTATTGTTCGTTTCTCAACTGTCATCCATGAGCGTGGCAGTCCCGAGACTCTCAGAGATCCTCGT
GGTTTTGCTGTTAAGTTTTACACCAGAGAG
GGGAACTTTGATCTTGTTGGGAACAACTTCCCTGTATTCTTCGTCCGTGATGGAATGAAATTCCCTGACATGGTCCATGCATTGAAACCG
AATCCCAAGTCCCACATTCAGGAGAACTGGAGAATACTGGACTTCTTCTCCCACCACCCAGAGAGTTTGCACATGTTTTCGTTCCTCTTTGATGATCTCGGTATCCCACAGGACTACAGG
CACATGGAAGGTGCTGGGGTCAACACTTACATGCTAATCAACAAAGCTGGAAAAGCTCACTATGTGAAATTCCACTGGAAGCCGACTTGTGGGATCAAATGCCTGTCGGATGAGGAAGCT
ATCAGAGTTGGAGGATCCAATCACAGCCATGCTACTAAAGATCTCTATGACTCGATCGCAGCCGGGAACTATCCACAGTGGAATCTCTTCGTTCAGGTGATGGATCCTGCCCACGAAGAC
AAATTCGATTTCGATCCGCTTGATGTCACAAAGATCTGGCCTGAAGATATCTTGCCTCTACAACCTGTTGGCCGCTTGGTCTTGAACAAAAACATCGACAACTTCTTTAACGAGTACGAA
CAGATTGCTTTCTGTCCTGCTCTTGTGGTTCCAGGCATCCACTATTCAGATGATAAACTACTCCAGACCCGGATCTTCTCCTACGCTGATAGTCAGAGACACCGTCTTGGACCAAACTAT
CTGCAACTACCTGTCAATGCCCCTAAATGTGCTCACCACAACAATCACCATGATGGTTTTATGAACTTCATGCACAGGGATGAGGAG
GTCAATTACTTCCCTTCAAGGTTGGATCCAGTT
CGCCATGCCGAAAAATACCCTACAACTCCTATAGTCTGCACTGGAAATCGTGAGAAG
TGCTTCATTGGGAAGGAGAACAACTTCCAGCAACCAGGGGAGAGATACCGTTCCTGGGATTCA
GACAG
GCAAGAGCGGTTCGTAAAGCGTTTTGTTGAAGCGCTTTCGGAGCCTCGTGTCACGCACGAAATCCGCAGCATTTGGATCTCTTACTGGTCTCAGGCAGACAAATCACTGGGACAG
AAACTAGCGACTCGTCTTAACGTGAGGCCAAACTTCTGA

Retrieve as FASTA