Entry information : AlyKat03
Entry ID 7467
Creation 2010-08-10 (Christophe Dunand)
Last sequence changes 2010-08-10 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2010-12-24 (Marie Brette (Scipio))
Peroxidase information: AlyKat03
Name AlyKat03
Class Catalase    [Orthogroup: Kat001]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Arabidopsis
Organism Arabidopsis lyrata    [TaxId: 59689 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AlyKat03
start..stop
S start..stop
AtKat03 1024 0 1..492 1..492
BnKat03_other 1016 0 1..492 1..492
ThasKat05 853 0 1..492 1..492
ThasKat04 851 0 1..492 1..492
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 8816842..8816856 15 N° 2 8817865..8817961 97 N° 3 8818135..8818412 278 N° 4 8818515..8819291 777
N° 5 8819375..8819464 90 N° 6 8819564..8819725 162 N° 7 8819817..8819876 60  
join(8816842..8816856,8817865..8817961,8818135..8818412,8818515..8819291,8819375 ..8819464,8819564..8819725,8819817..8819876)


exon

Literature and cross-references AlyKat03
DNA ref. Phytozome 12:   scaffold_1 (8816842..8819876)
Protein sequence: AlyKat03
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   492
PWM (Da):   %s   56562.48  
PI (pH):   %s   7.69
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MDPYKYRPSSAYNAPFYTTNGGTPVSNNISSLTIGERGPVLLEDYHLIEKVANFTRERIPERVVHARGISAKGFFEVTHDISNLTCADFLRAPGVQTPVIVRFSTVVHERASPETMRDIRGFAVKFYTRGNFDLVGNNTPVFFIRDGIQFPDVVHALKPNPKTNIQEYWRILDYMSHLPESLLTWCWMFDDVGIPQDYRHMEGFGVHTYTLVAKSGKVLFVKFHWKPTCGIKNLTDEEAKVVGGANHSHATKDLHDAISSGNYPEWKLFIQTMDPADEDKFDFDPLDVTKIWPEDILPLQPVGRLVLNRTIDNFFNETEQLAFNPGLVVPGIYYSDDKLLQCRIFAYGDTQRHRLGPNYLQLPVNAPKCAHHNNHHEGFMNFMHRDEEINYYPSKFDPVRCAEKAPIPTNSYTGIRTKCVIKKENNFKQAGDRYRSWAPDRQDRFVKRWVEILSEPRLTHEIRGIWISYWSQADRSLGQKLASRLNVRPSI*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 1, 6 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGATCCTTACAAGGTATATATCTCCATATTCTTCTTTCTTCTTATTTTAGGCTTATCTTGAATCGATCATTTCTTTTTTTTTTTGTCAAAAATCTTGAATAGATCATGTTTGTTTAGT
TATGCTCGTTTTTAGCTGATTTTGATGAGAAAAATAAAGTTAGATTGGATTTATGTTCGTAAATCTTCGCGTTAAAATGATTTTTTGCTCAAAAACGACTTACTTAATTCTATGATCGCC
TGAACTCTAAGTCGATGATGTTGATTTTTGTTTTGGCTGGCTATCTTTTACTAAAACGTTTTGATCTATAAACAACCACTGCATGAGAAAGACACGCCACATGTGGTTTTTTCTTGTTTT
TTTTCCTTAGATTAGAAGTGATTTTTGTTGTTTATGTTTTTTCATTACACACGTGCTCTAAAATCGGACGTTCCGATGATTTAATCGATAGTTTAAACGTCCGACGGTATATTATTTTAG
TGATTTTAGCCAAATCATCAACTAAATGATTTCTCAGATATACTGAACACCTGAGTAATCAAATCTTCACGTTTGAATAATCAAATTTAAATAATCGTTTAAGTTAGATATAAACATACG
ATAAGTATATTTTAAACACTCGGTTAATCTATCAATACAATTATTTTTTTCATACAACACAAAAGTTCTCTCGCACACCGACGAAATAAAACAAAATTCTATCAGTTCGTATCATTAAAA
GTGTTATGTAGATCAAACAAGACTTGAATATACTTAAAAAAGTATAACAATCGAATAAATATATACTACTCCGACATGTTACTGTTTTCGTCACCAAATCTAAAGACTTCTTCGTTAAAT
AATGGTCTTTGGTCGGGATGGACCACCTGGCGATCCGGTCCGACCAGGAAACCGGGTTTTGATTTGTTCGGGTTGCATCAGAAAATTAGGGCTTTCTACAAATTTTGTGGATTGTTCATG
TCGAATCCGTTCGATTGTTGATTCAATTAACCAAATTTCACCTCCGAATTATGGTGATTGCAGTATCGTCCTTCGAGCGCGTACAACGCCCCATTCTACACCACAAACGGTGGTACTCCA
GTCTCCAACAACATCTCTTCCCTCACCATCGGAGAGAGAG
GTATTTGTAATCCTGAATTCAAAGTATCTAACCATAAGAATCGGAACTGTAACCTTGTACTTGCTGGATTTATGGAAGAG
ATGAAACTGAGATATAGAGTCTAAAGCTAGGATCTTGTTAATGGAGTCTGATGTGTTCTTTTAAGTTAACATGTGTTGCTTCGTATTGAGCAGGTCCGGTTCTTCTTGAGGACTACCATC
TGATCGAGAAGGTTGCCAATTTCACCAGAGAGAGGATCCCTGAGAGAGTGGTTCATGCCAGAGGAATCAGTGCTAAGGGTTTCTTTGAAGTCACCCATGACATTTCTAACCTCACTTGTG
CTGATTTTCTCAGAGCTCCTGGTGTTCAAACTCCGGTTATTGTCCGTTTCTCCACCGTTGTCCACGAACGTGCTAGTCCTGAAACCATGAGGGATATTCGTGGTTTCGCTGTCAAGTTTT
ACACCAGAGAG
GTATAAGAAAAGATTTAAGTTTCCATTTTTAATTTAATCAGTCTTTTAGCTTCTTTAGAATCTGTACTGATTTGTGTCTTGCTACTGTTTTGATAATTTCAGGGGAACT
TTGATCTTGTTGGGAACAACACTCCGGTGTTCTTCATCCGTGATGGGATTCAGTTCCCGGATGTTGTCCACGCGCTGAAACCAAACCCGAAAACAAACATCCAAGAGTACTGGAGGATTC
TGGATTACATGTCCCACTTGCCAGAGAGTTTGCTCACATGGTGCTGGATGTTTGATGATGTTGGTATTCCACAAGATTACAGGCACATGGAGGGTTTCGGTGTCCACACCTACACTCTTG
TTGCCAAATCTGGAAAAGTTCTCTTTGTGAAGTTCCACTGGAAACCAACTTGCGGGATCAAGAATCTGACTGATGAAGAGGCCAAGGTTGTTGGAGGAGCCAATCATAGCCATGCCACTA
AGGATCTCCACGATGCCATTTCATCGGGCAACTACCCCGAGTGGAAACTTTTCATCCAGACCATGGATCCTGCGGATGAGGATAAGTTTGACTTTGACCCACTTGATGTGACCAAGATCT
GGCCTGAGGATATTTTGCCTCTGCAACCGGTTGGTCGCTTGGTTCTGAACAGGACCATTGACAACTTCTTCAATGAAACTGAGCAGCTCGCTTTCAACCCGGGTCTTGTGGTTCCTGGAA
TCTACTACTCAGACGACAAGCTGCTCCAGTGTAGGATATTTGCTTATGGTGACACTCAGAGACATCGTCTTGGACCAAATTATCTGCAGCTACCAGTGAATGCTCCCAAATGTGCTCACC
ACAACAATCACCATGAAGGTTTTATGAACTTCATGCACAGAGACGAGGAG
GTACGTCTTAGTACCACTTGAGCTACCATTGTTAGTCTTTTGACTTGGAATCAAAATTCTTATAGGGTGT
TTGCTTTTTACAGATCAATTACTACCCCTCAAAGTTTGATCCTGTCCGCTGTGCCGAGAAAGCTCCTATCCCTACAAACTCCTACACTGGAATCCGAACAAAGGTCTGATTCATGACATG
CGTTCTTTAAATCTTGAAAACCTCAGACTCAATATATTGAAAAGTGTCTGCTAAGAAAACCTTGAAACTGCTAATGTTGCAGTGCGTCATCAAGAAAGAGAACAACTTCAAACAGGCTGG
AGACAGGTACAGATCATGGGCACCAGACAGGCAAGACCGGTTTGTTAAGAGATGGGTTGAGATTCTGTCGGAGCCACGTCTCACCCACGAGATCCGCGGCATCTGGATCTCTTACTGGTC
TCAG
GTGAGAACAAAAAACCACTCAGTGAAATCTCTGCTTCCTTTTTCACCAAATATTCAGCAAACTAAACATTATAATCTCTCTTATCTTTCAGGCTGATCGATCTCTGGGACAGAAAC
TTGCAAGCCGTCTGAACGTGAGGCCAAGCATCTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGATCCTTACAAGTATCGTCCTTCGAGCGCGTACAACGCCCCATTCTACACCACAAACGGTGGTACTCCAGTCTCCAACAACATCTCTTCCCTCACCATCGGAGAGAGAGGTCCGGTT
CTTCTTGAGGACTACCATCTGATCGAGAAGGTTGCCAATTTCACCAGAGAGAGGATCCCTGAGAGAGTGGTTCATGCCAGAGGAATCAGTGCTAAGGGTTTCTTTGAAGTCACCCATGAC
ATTTCTAACCTCACTTGTGCTGATTTTCTCAGAGCTCCTGGTGTTCAAACTCCGGTTATTGTCCGTTTCTCCACCGTTGTCCACGAACGTGCTAGTCCTGAAACCATGAGGGATATTCGT
GGTTTCGCTGTCAAGTTTTACACCAGAGAG
GGGAACTTTGATCTTGTTGGGAACAACACTCCGGTGTTCTTCATCCGTGATGGGATTCAGTTCCCGGATGTTGTCCACGCGCTGAAACCA
AACCCGAAAACAAACATCCAAGAGTACTGGAGGATTCTGGATTACATGTCCCACTTGCCAGAGAGTTTGCTCACATGGTGCTGGATGTTTGATGATGTTGGTATTCCACAAGATTACAGG
CACATGGAGGGTTTCGGTGTCCACACCTACACTCTTGTTGCCAAATCTGGAAAAGTTCTCTTTGTGAAGTTCCACTGGAAACCAACTTGCGGGATCAAGAATCTGACTGATGAAGAGGCC
AAGGTTGTTGGAGGAGCCAATCATAGCCATGCCACTAAGGATCTCCACGATGCCATTTCATCGGGCAACTACCCCGAGTGGAAACTTTTCATCCAGACCATGGATCCTGCGGATGAGGAT
AAGTTTGACTTTGACCCACTTGATGTGACCAAGATCTGGCCTGAGGATATTTTGCCTCTGCAACCGGTTGGTCGCTTGGTTCTGAACAGGACCATTGACAACTTCTTCAATGAAACTGAG
CAGCTCGCTTTCAACCCGGGTCTTGTGGTTCCTGGAATCTACTACTCAGACGACAAGCTGCTCCAGTGTAGGATATTTGCTTATGGTGACACTCAGAGACATCGTCTTGGACCAAATTAT
CTGCAGCTACCAGTGAATGCTCCCAAATGTGCTCACCACAACAATCACCATGAAGGTTTTATGAACTTCATGCACAGAGACGAGGAG
ATCAATTACTACCCCTCAAAGTTTGATCCTGTC
CGCTGTGCCGAGAAAGCTCCTATCCCTACAAACTCCTACACTGGAATCCGAACAAAG
TGCGTCATCAAGAAAGAGAACAACTTCAAACAGGCTGGAGACAGGTACAGATCATGGGCACCA
GACAGGCAAGACCGGTTTGTTAAGAGATGGGTTGAGATTCTGTCGGAGCCACGTCTCACCCACGAGATCCGCGGCATCTGGATCTCTTACTGGTCTCAG
GCTGATCGATCTCTGGGACAG
AAACTTGCAAGCCGTCTGAACGTGAGGCCAAGCATCTAG

Retrieve as FASTA