Entry information : AlyPrx38-2
Entry ID 7564
Creation 2010-08-11 (Christophe Dunand)
Last sequence changes 2010-08-11 (Christophe Dunand)
Sequence status complete
Reviewer Achraf Jemmat
Last annotation changes 2015-12-31 (Achraf Jemmat)
Peroxidase information: AlyPrx38-2
Name AlyPrx38-2
Class Class III peroxidase    [Orthogroup: Prx038]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Arabidopsis
Organism Arabidopsis lyrata    [TaxId: 59689 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AlyPrx38-2
start..stop
S start..stop
AhalPrx27 666 0 1..346 1..346
AhalPrx37 663 0 1..346 1..346
AlyPrx38-1 660 0 1..346 1..346
AlyPrx37 647 0 16..346 15..345
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 18916861..18917067 207 N° 2 18923299..18923490 192 N° 3 18923578..18923746 169 N° 4 18923855..18924327 473
join(18916861..18917067,18923299..18923490,18923578..18923746,18923855..18924327 )


exon

Literature and cross-references AlyPrx38-2
DNA ref. Phytozome 12:   scaffold_6 (18916861..18924327)
Protein sequence: AlyPrx38-2
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   346 (324)
PWM (Da):   %s   38024.21 (35596.8)  
PI (pH):   %s   6.89 (6.29) Peptide Signal:   %s   cut: 23 range:23-346
Sequence 387
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MYSSLIKLGFLLLLLQVSLSHAQLSPSFYDKTCPQVFDIVTNTIVNALRSDPRIAASILRLHFHDCFVNGCDASILLDNTTSFRTEKDAFGNANSARGFDVIDKMKAAVEKACPGTVSCADMLAIAAQESVVLAGGPSWRVPNGRRDSLRGFMDLANNNLPGPSSTLQELKDRFKNVGLDRPSDLVALSGGHTFGKNQCQFIIDRLYNFGDTGLPDPTLDKSYLATLRKQCPRNGNKSVLVDFDFRTPTVFDNKYYVNLKENKGLIQTDQELFSSPDASDTLPLVREYADGQGKFFDAFEKAMIRMSSLSPLTGKQGEIRLNCRVVNSKSRIMDVVEDAIEFASSM

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 6, 3 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGTATTCCTCTTTGATAAAATTGGGATTTCTTCTTCTTCTTCTTCAGGTCTCATTGTCTCATGCTCAACTAAGCCCTTCCTTTTACGATAAAACATGTCCGCAAGTCTTTGACATTGTAA
CCAATACCATTGTCAATGCTCTGAGATCAGACCCTCGCATCGCTGCAAGCATCCTTCGTCTTCATTTCCACGACTGCTTTGTTAAT
GTAAGATACCACTAAATTCGATAAATTCATGTAT
ATATTAAGTCTTTTGGTTCTTTGATAGTTTATCCTTAATAGTGAGAATGCTTTACGGATAGTATAAACGTAAAATAAGGATATGACATTTATAAACCTGAAAATGTGATAGACATTTCGG
TTTCAACTCAAACTACAGATTTCTTTTGATAGTTTGGTTTTGAAATTTTGGCTTTCTTTTGGTTGTATTACAGAATAGAAACAATAAAAGTTAAATAAAAATACAAAGTAAGAAAAAAAA
AGTTATATATACATATAAATTATTTTTGGAAGTTTGATTTTGTTTGTTTTGACTAGTTTTTGGTTCAATTTGGAGCGGCTATATTTACTATGGACCAACCACTTCTTTAGGAAATTGATG
ACTAGCTATTTTGCTTTCTTATCTCAAGTGTCAGATTTTGTCTTCAAAGCATAGTCAAAAATTAAAATTCTTTTCGATTATAATATAATAATTAGTTAACTCATAATTTTTTCCTTGCAA
TATTCTTTTGGATTATTAGATGTCGTGGCGCATTAATGCTGTTTTCTTTTTTTTTTTTTTTTTTTTTTTTTTTGAATGCAATGTTAAATTATATTCAAAAAGAAAAATGTACGATTTTAC
AACTTGTGCATCGGTTGGTTGAAACAAAATTTGAAGCAAAATTTGAAACTATTTTGACTATCTAGACCTCCCGTTGACGCTTAGCTGCGAGCTTGAAGCCAGAGTTGGTACGCGTCGTCA
TACCTTCTGTCTCCCATAAGTCGGACTGCTGAGATTTGATTCCTTACATGTTTGTCAATCCACCCCGTGATGCGTTCAGCTGTTTGTGGGTTCTCTCCATGTCGCCGCCCATTCCTTTCT
CTCCATATGGTATAGGTAACTGCTTGAAATACATATCGAAAGAGGAAGCCCTCTACTCGGTTGAGCTGTGTGGAAGATATAATGTCAAGAAGAAGAAGCCAATCTGTTGTGTATCGAGTT
TTGAGAAGCCCCTTTGCAAGGGCTGCCCAAATGGTAGAGCTGAAATCACAACCAAAAAAGAGATGATTCCGGGTTTCTAAACATCTATGACAAAGAACACATGTTCCTGCTCCGCCTTGC
CATTTGATCATACGATTGCCCGTAGAGAGCCTGTTTTGAGCTGCTAACCACACACAAAAGGAGAATTTTGGTGTTGCGTGTGCAAACCAAACTCCCCGGTGCCATGAGACCGTGCTAGAG
GTTATTCGGATATGATTCCAAGTATCTTTAGCTGAGAACTTCGGTTTAAAGATATCATTTTTCCCTCTCCATAGAACAGTGTCCCCTTGTTCCTTCCTTTTTTCCCGCTGCTCTTGTAAC
GCATCTTCCATTGCGTTGAGTGTGGCTGCCCGATGTCTTCTTCTCCTTCGATTTGACCAGGCAGCCGCTAGCGAGCTTGTTCGACTGATACCCATATCAATGACTCCTCGAGCACCCACA
ATATCTACCAATCTCCCCATTGAAGACCAATCATCATACCAGAAAGATGTAAGTTCTCCGTTTCCCACTTCCACCTTGCAGAACTGCTTTGCTACCTCTCTATACTTTAGGAGTTTTTTC
CAAATCCAGGAACCCATATTAGTGCTGCTGTTGATGGACCAGAATGAAGTTTTCTTAAGAAGGTACATTTGGATCCACTTCACCCATAAAGAGTTGCCCTGAGATACTATGCGCCAAATA
AGCTTTAGACAGCAAACATTGTTAGCTTCTTTGAGTGAACGCAGCCCTAGACCACCCTCCTGCTTCGGTTTACAAACATTCTCCCAAGATATCTTTGCTCTATGTGCATTCATATCCTTA
CCCGACCATAAAAAGGCTGAACACATTTTTTCTATGTCTTGAATGCACTCGTTTGGTAGTCTATACGCAGCCAACCAAAAATTACATACACTCCACAACACTGATGCAATTAGATTCAGC
CGACCTGCAAATGATAGGAACCGTGATGTCCAAGACTCAATCCTTTTCCGAAGCTGCTCTACTAAAGGCATGCAATCTGCTCTTGAAAGCCGTTTTGTGACCAGGGGAAGGCCAAGATAA
CGGACTGGGAGCTTACCAACCTCAAAAGGGAAACGAGTAGCCAGTTGTTGAATTGAAGTATTTGGTATACCTGCTAAATATAGGGTCGATTTCTCCATACTTATTTTCAATCCGGAGCAG
CGAGCAAACTCATCAAAAACTGAGACAATACCTTCAACAGAACGCACTTTACCATCCGATAAAACCATGATATCGTCTGCAAAACTTAGGTGTGTGAGTCCCAACTTTTTGCAGTGTGGA
TGGTAGCCAAACTGCCTTGCATCCGCAGCTTTATCGAGCATTTTTGAGAGGATATCCATACTAATCACAAACAAGTACGGCGAGAGAGAGCAGCCCTGTCGTAGACCTCTTGAGCTTCGA
AAATATCCAACCAATTCTCCATTTACCTGAACTGAGAAAGAAGCCGTAGTAACACATAGCATAATCCAATGAATAAATGTTGGTGGAAAATTCAGTGCCGAGAGAACTTTGTGTAGAAAA
GACCATTGAACCGAGTCAAATGCTTTAGATAGATCAATCTTTATAGCACAGCGACTTGTGACAGATTCCTTATGGTAGTCCTTGACAAGTTCGGTAGCGAGCAGCACATTTTCAATCAAT
AAGCGGTCTTTAACAAATGCCGATTGATTGCCGGAGATAAATTTGGGGAGTACACCTTTGAGCCTGTTGGCGATGATTTTTGAAATGACCTTATATATCACATTGCAGCACGAGATAGGG
CGGAAGTCTTTCATCTCTTTTGCACCTTTCTTTTTGGGTATGAGAGCCAATATGGTGGAGTTGATGCCCTTTGGTAGGAATCCTTTTGCAAAAAAAGATTGTACCGCTAGAATAAATTCT
TTTCCAATTAGCTCCCAGGAAGCCTTGTAGAATTCTGAAGTGTATCCATCCGGTCCCGGAGATTTATCATTAGGCATACTGAATACAACCTTCTTGATTTCCTCCCTTGTAACCTCATGA
GTTAACTTCTGTTGATCCAGATTTGTGCATCGAAATGGTAACAACTGCTGCAGTTTCTCAACCGTGATAGCATCAAAATCTGCAGGTATATGTTGCAAAAAATCCTGGAAATGTCGTTCA
GCTTCGGTTTTGATTTCAGCATCTTCAACTAGTACCCTACCATCGTGGCATAAAATTTCTTTGATACTATTTGTTGCTTCCCGCATTGCAGCCGCCCTATGAAACTGTTTATTATTTTTA
TCTCCGACCTGTAGCCAGTGAAGTTTTGATTTCTGCTTTAAGTACTTCTCCTCCAAACTAGACAGCAGCTCCCATCTATTATAAGCCACATTTTCCTCTTCCATAGATCTCACTGTTGGA
TTCGTCAGGTTGGCCTGTTGTTTTTGACAGAGAGTCTCATATGCCTCTTTTGTCTTCTTGACCAAATCTCCCACACGGTCTTTAGCCAAGCTACGAAGCATTGGCTTTAGTCCTTTTAAT
TTTTTCGAGAACCGGAACAACGTGGATGTGGATAAGAACAGCTCCTCAGAATCTTTCCAGAAATTGTTGACCGCCGGTGAAAACTCAGGCATCTCTGTTAATACATTTACAAACTTGAAC
GGTTTCCGGCGCTTTGGTACGTGACTTACTCCTCCAATTTGCATAATCCGACAACGTAAATGATCCGAGCAACCCCCTGCCTCAAAAACATTATACGCTTGTGGAAATGCCTTTAGCCAA
GCATCATTCATTAACACTCTGTCCAGTTTCTTCAAAATTAAGTCGTTTTCCCGTTTGTTACACCAGGTGTAAAGGGGCCCATGAGAAGCCATGTCTGAAACTGAACAGTAATTCACTAGT
TCCCGAAAGTCACGCATCCCCAACGTGACCAGCGGGTTAGTATCAACCCGAGAGTGCTCAGCCATATCCAAAGTAACGTTAAAATCTCCAAATATCAGCCACGGTTTGTTGCGGATAATA
GGAGAATCGAAGTGATCACGGAGTTCCTGCCAAAGTACTTTCCTCTCTTCAACAAGATTGGAAGCATACACGAAAGAACAGAAAAATTCCTCCCCTTGATTTTCCAACTTGACCGAGCAT
GTAATTACTTGACCACTCTTATAAACAGGGCTCAATCGCACATTATTTTGCCAAAGAATCCAGATACGACCTCTGCGATTGTGTTCATAATTTGTCATTATGGACCAATTAGGAAACAGC
TGACTTCCTAATCTTTGAGCCTTATTTTCCCTTACTCTTGTCTCAAGCAAACAACCAAACTGAAAATTATTTCCATCCACCCACTTCTTGATAACGGAATGTTTTGAAGATTTGTTTAAG
CCGCGAACATTCCAAAAGAAACCCGACATTAATGATGTTTGGGGTTCTTCTTACTCAGATCTCTAGAGGGGTCTCTAGCCGATAGAGCATGAAGTTGAGAGCTTGTCTTATGAGCTGTTT
TTGTACCTCGAGGCAAGGATGGTCGCAATGGTACCTCTATCCGTGGAGGGCGAGTTTTCCCCGCATTTCCTTGCGTCCGAGTTGTCTCTGTCAACTGATCATCTTGTTGGTCGGGTATGG
ATTCAGAGTTTGCTTCCTCTGTCTTTCCTTCTTCTGGTTTGTCTTCCTCTACGACCTCTTCTGCCTCCAAAATAGAGTAGGTGTTGGATAATATTGAGACCTCTCCGTACGTTAAACTCT
TTTGCTTCTGACTGGGACTTGCACGCCCTGATTTGGGAGTTATCCATCCCTCCATCGACTCCTCTGTTTTTTCTGTAGCTAAATCTTGGTTTCTACTCTGCAACTCTTTCTCCTCTGTTT
CAATACCCGTGGCGACCAAATCTGCAGCTTCCCCATCCTTTGGTCCATCAATTTTTCCTGTTTCCGTTGCTTTTTCCTCTTGAACCTTCTGTCCCTTACCTGATAAACAAGTGGTACTTA
GATGGCCCCATTTCTTACAACAACTACACCGCGGAGGAAGCCACGGATAAGAGTACTTGATCGTAGAATCCAGCTCTCCTTCCTCTTCTCCCGTGAATACATATTCCTTTGGGAGTTCTT
TCGTCAAATCTGCTTCTACTAGGATTTGCGCTTCATCGAAACTAACACATGCCTCAGTTTTTGGATGCAAACGTTTTGGTTTACCAACTGCACTAGATAGGAACTCCAATCCCTTGTCCG
TAAACATGGTAGGTGGAACATTTGTTAATGTGACCCAAAGCGGTATTGACTTCATTGCAGGTTGTGCTTCCTCCGCAAAAGGAGTCCATTTAGAGACTATCATGGGGATGTCCATGATGT
TCCACATTCCTCTGTTTAAGATCCTATGCCTCATGCCTTCATTTCTTATACGAAACTTCACCGTTGATTCATTCACCACATATACATCAATTAAGGAAGATCGATCACCCAAGCGCCAAA
TCTTATTCACAATCATGTGAATCTTACCAACATGTGGAGCCTTCTCATTCAAAAATTTTCCAATCAAGAAGTCCTCCCAGAGCGGTTTCGCTCCCATAAAAACCTCTTTTGGAACAACCA
CTTTTTCACAGCCATCTACTTCCGAGACTACAAACTTCTGTTGAGTGAAAGTATGTTTCTGCGCTGCTTGGAGAAAGGACCTCCTCACAGGCTGAACTCCCGTCGATTGATTTGATGATG
ATACTTCATGATTCTTACCCTCTTCCTTCCCCGACTTACTTTCCCTAGAAACCTCCATCGAGCCCTCTAATGGCGTCGCGCTTTTCCTTTGCAAAGCTGGAAATTCATCAACGTGACTAA
CTGCAACCACCGGAGAAGCCCTGCCATCTCCCGTTCCCGGACTACCCACCCGACGGCCTGGAGAAGCCGCCGACGGCGTCATGCGTGGAGAAAACGCAAAAAACCTAGTCGCCTCTTTTT
TCACCTTGCCACGTCAGCAGAGAAAAAACAAAACTACACCAAAAACATGTAGAATTAACCACCAAGATAGATATCTTATTTAAAACGATTGCTGTTTTCGGATTTCGGATTCACGTAATA
GCTAGCTAGCTAGTGATTGTGTGATACTAGATTTACTATTTTTCTTAGGGTAAAAAGAGAAGAAAAAAATGCAGTAGTTGCGGGTAAAGTATGTATGTGGAAGTATAGCTGGTTCATATA
TAAATTCAAAAATTAAATAAACTGTTTATACAGATGTTGTGATTTAACAATGTAACTAATATTTTGTTTGGAAAAAGGGATGTGATGCATCGATATTGTTAGACAACACAACATCGTTTA
GGACGGAGAAAGACGCCTTTGGGAACGCTAATTCCGCTCGAGGTTTCGATGTGATCGACAAAATGAAAGCCGCCGTGGAGAAAGCATGTCCTGGAACCGTTTCGTGTGCCGATATGCTCG
CCATCGCAGCTCAAGAATCTGTCGTTTTG
GTATGCATCTTTTACTATGCTATGCAAATGGTTTCTAGAGTACCATTTTGTTAAAATATTTAGACCAAATATAATTGTTTACAATAGGCAG
GAGGTCCTTCATGGAGGGTTCCAAATGGAAGAAGAGACAGCTTAAGAGGGTTTATGGATCTTGCTAATAATAACCTTCCAGGTCCATCCTCTACCCTTCAAGAACTTAAGGATAGATTCA
AAAATGTCGGACTAGACCGTCCTTCTGATCTCGTTGCTCTTTCCG
GTATGTTATCTCATTTGAAACATTTTCATCTATAGTTGTAATCACTAACAACTCTACATGACTATTGGTTTTGTT
TATTTATACTTTTGATATTTTTTCTTTCGTTAGGTGGTCACACCTTTGGCAAAAACCAATGTCAGTTCATAATAGATCGCCTTTACAACTTCGGTGATACCGGTTTACCCGACCCAACCC
TTGATAAATCTTACCTCGCAACACTCAGAAAACAATGTCCACGTAATGGAAACAAGAGTGTCTTGGTAGATTTTGATTTCCGTACACCAACAGTCTTTGACAACAAATACTATGTGAATC
TCAAGGAGAACAAAGGACTTATCCAGACCGACCAAGAGTTATTCTCTAGCCCTGATGCTTCAGACACTCTCCCTTTAGTCCGAGAATACGCTGATGGTCAAGGGAAATTTTTCGATGCGT
TCGAGAAGGCAATGATAAGAATGAGTAGTCTTTCACCTTTAACAGGGAAACAAGGAGAAATTAGATTGAACTGTAGAGTGGTGAATTCGAAATCGAGAATCATGGATGTGGTAGAAGATG
CTATTGAATTTGCTAGCTCAATGTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGTATTCCTCTTTGATAAAATTGGGATTTCTTCTTCTTCTTCTTCAGGTCTCATTGTCTCATGCTCAACTAAGCCCTTCCTTTTACGATAAAACATGTCCGCAAGTCTTTGACATTGTAA
CCAATACCATTGTCAATGCTCTGAGATCAGACCCTCGCATCGCTGCAAGCATCCTTCGTCTTCATTTCCACGACTGCTTTGTTAAT
GGATGTGATGCATCGATATTGTTAGACAACACAA
CATCGTTTAGGACGGAGAAAGACGCCTTTGGGAACGCTAATTCCGCTCGAGGTTTCGATGTGATCGACAAAATGAAAGCCGCCGTGGAGAAAGCATGTCCTGGAACCGTTTCGTGTGCCG
ATATGCTCGCCATCGCAGCTCAAGAATCTGTCGTTTTG
GCAGGAGGTCCTTCATGGAGGGTTCCAAATGGAAGAAGAGACAGCTTAAGAGGGTTTATGGATCTTGCTAATAATAACCTTC
CAGGTCCATCCTCTACCCTTCAAGAACTTAAGGATAGATTCAAAAATGTCGGACTAGACCGTCCTTCTGATCTCGTTGCTCTTTCCG
GTGGTCACACCTTTGGCAAAAACCAATGTCAGT
TCATAATAGATCGCCTTTACAACTTCGGTGATACCGGTTTACCCGACCCAACCCTTGATAAATCTTACCTCGCAACACTCAGAAAACAATGTCCACGTAATGGAAACAAGAGTGTCTTGG
TAGATTTTGATTTCCGTACACCAACAGTCTTTGACAACAAATACTATGTGAATCTCAAGGAGAACAAAGGACTTATCCAGACCGACCAAGAGTTATTCTCTAGCCCTGATGCTTCAGACA
CTCTCCCTTTAGTCCGAGAATACGCTGATGGTCAAGGGAAATTTTTCGATGCGTTCGAGAAGGCAATGATAAGAATGAGTAGTCTTTCACCTTTAACAGGGAAACAAGGAGAAATTAGAT
TGAACTGTAGAGTGGTGAATTCGAAATCGAGAATCATGGATGTGGTAGAAGATGCTATTGAATTTGCTAGCTCAATGTGA

Retrieve as FASTA