Entry information : AlyRboh04 (AlyRbohD)
Entry ID 7583
Creation 2010-08-11 (Christophe Dunand)
Last sequence changes 2010-08-11 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2010-12-24 (Marie Brette (Scipio))
Peroxidase information: AlyRboh04 (AlyRbohD)
Name (synonym) AlyRboh04 (AlyRbohD)
Class Respiratory burst oxidase homolog    [Orthogroup: Rboh001]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Arabidopsis
Organism Arabidopsis lyrata    [TaxId: 59689 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AlyRboh04
start..stop
S start..stop
AtRboh04 1842 0 1..920 1..921
ThasRboh04-2 1586 0 3..920 1..945
ThasRboh04-1 1526 0 3..920 1..929
PtRboh04 1429 0 18..920 8..926
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 9954828..9955455 628 N° 2 9955541..9955703 163 N° 3 9955896..9955944 49 N° 4 9956269..9956382 114
N° 5 9956837..9957649 813 N° 6 9957744..9957839 96 N° 7 9957994..9958783 790 N° 8 9958896..9959005 110
join(9954828..9955455,9955541..9955703,9955896..9955944,9956269..9956382,9956837 ..9957649,9957744..9957839,9957994..9958783,9958896..9959005)


exon

Literature and cross-references AlyRboh04 (AlyRbohD)
DNA ref. Phytozome 12:   scaffold_8 (9954828..9959005)
Protein sequence: AlyRboh04 (AlyRbohD)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   920
PWM (Da):   %s   103742.54 Transmb domain:   %s   o377-396i517-539o559-581i739-756o
PI (pH):   %s   9.66
Sequence 961
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MKMRRGNSSTDHELGILRGANSDTNSDTESIASDRGAFSGPLGRPKRASKKNARFADDLPKRSNSVAGGRGDDDEYVEITLDIRDDSVAVHSVQQAAGGGAHLEDPELALLTKKTLESSLNNTTSLSFFRSTSSRIKNASRELRRVFSRRPSPAVRRFDRTSSAAIHALKGLKFIATKTAAWPAVDQRFDKLSADSNGFLLSSKFWECLGMNKESKDFADQLFRALARRNNISGDAITKEQLRIFWEQISDESFDAKLQVFFDMVDKDEDGRVTEEEVAEIISLSASANKLSNIQKQAKEYAALIMEELDPDNAGFIMIENLEMLLLQAPNQSVRMGDSRILSQMLSQKLKPAKESNPLVRWSEKIKYFILDNWQRLWIMMLWLGICGGLFTYKFIQYKKNKAAYDVMGYCVCVAKGGAETLKFNMALILLPVCRNTITWLRNKTKLGTVVPFDDNLNFHKVIASGIVVGVLLHAGAHLTCDFPRLIAADEETYEPMEKYFGEQPENYWWFVKGVEGWTGIVMVVLMAIAFTLATPWFRRNKLNLPKFLKKLTGFNAFWYSHHLFIIVYALLIVHGIKLYLTKIWYHKTTWMYLAVPILLYASERLLRAFRSSIKPVKMLKVAVYPGNVLSLHMTKPQGFKYKSGQYMFVNCRAVSPFEWHPFSITSAPGDDYLSVHIRTLGDWTRKLRTVFSEVCKPPTAGKSGLLRADGGDGNLPFPKVLIDGPYGAPAQDYKKYDVVLLVGLGIGATPMISILKDIINNMKSPDSDIENNNSNNNSKGFKTRKAYFYWVTREQGSFEWFKGIMDEVSELDEEGIIELHNYCTSVYEEGDARVALIAMLQSLQHAKNGVDVVSGTRVKSHFAKPNWRQVYKKIAVQHPGKRIGVFYCGAPGLTKELKNLALDFSRKTTTKFDFHKENF

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 8, 7 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGAAAATGAGACGAGGCAATTCAAGTACCGACCATGAACTTGGGATTCTACGAGGAGCTAACTCGGATACCAACTCGGATACTGAAAGCATCGCTAGCGACCGCGGCGCCTTCAGTGGTC
CGCTTGGTCGGCCTAAACGTGCGTCCAAGAAAAACGCAAGATTCGCCGACGATCTTCCCAAGAGAAGCAACAGTGTTGCTGGCGGCCGCGGTGACGACGATGAGTACGTGGAGATCACGC
TAGACATTAGGGACGACTCCGTGGCCGTCCACAGTGTCCAACAAGCAGCTGGAGGAGGAGCCCACCTAGAGGACCCGGAGCTAGCCCTTCTCACGAAGAAGACACTCGAGAGCAGCCTCA
ACAACACCACCTCCTTATCATTTTTCCGAAGCACCTCCTCACGAATCAAGAACGCCTCCCGCGAGCTCCGCCGTGTGTTCTCTAGACGTCCCTCCCCGGCCGTGCGGCGGTTTGACCGCA
CCAGCTCCGCGGCCATCCACGCTCTCAAAGGTCTAAAGTTCATCGCCACAAAGACTGCCGCGTGGCCTGCCGTCGACCAACGCTTCGATAAACTCTCCGCTGATTCCAACGGCTTCTTAC
TCTCATCCAAGTTTTGGGAATGCTTAG
GTAAATTATTCACTTCAGGCTAAACAATTCTATTATTAGTATTTCCATTTTTGTTAGTTTCATTTTTGGTTCTTTAAAACTCCAGGAATGAAC
AAGGAATCGAAAGACTTCGCAGACCAACTCTTTAGAGCATTAGCTCGCCGGAATAACATCTCCGGCGATGCAATCACAAAGGAACAGCTCAGGATATTTTGGGAGCAGATCTCAGACGAA
AGCTTTGATGCAAAACTACAAGTCTTTTTTGATAT
GTAAGCTTTTTTACTTATCTTCACCTAACCCACAATAAATATCTAACGCGTAATCACTATTTGTCGTTTTAATATTGACTCTTAA
TGAAAATTAAACGGTCATCAGAATTTAAGGACCAAAAATAATATTATTAATCATTTGTGGAGGTATGGTGGATTTGTAACTAATAAATGACATCACTGTTTGGTCAGGGTGGACAAAGAT
GAAGATGGGCGAGTAACAGAAGAAGAGGTGGCTGAG
GTGAGAAAAAACACACACCATTCAATAATTATCTTTTTCAAATATTTTATTATATTTATACATATTCTTGGTTGATTGTTATTT
TTTCTTATATTTTATACATATTCTTGGTTGATTATTTTGACAATTTTGTCCACGCGCAAATCCCCACTGACTTTATCTGCTGACGTTTACTCTTAACATCATCAATATATTAACTCCATC
TGAACACGACAAAAATGGTACTAGATAGTTAGAGTAGTCTTTATTACTTTAGCTTAGGTTATTAATGTTCAAATACTTTCTTTATCTTTTGTTTTCTAATTTGTTGGTTATTTATTGCAG

ATTATTAGTCTCAGTGCTTCAGCGAACAAGCTCTCTAATATTCAAAAGCAAGCCAAAGAATATGCGGCACTGATAATGGAAGAGTTGGACCCAGACAATGCTGGGTTTATTATG
GTACGT
GTGGTCCACTTTCACCCACTCAATCACACTAATGCTATATGTATGTCGTAAATTTAACCACCCTTAAAATACTAGGAAAAACGTGGAAAAACACAACGTTCTAGAAGTCTTAAGTGGTCA
AAATTATTGGGTCACCATGATGTTTATTTTTCAACTTGATTGGGCCATCTTGATTTTTTGACCAAACCAATCAACAAAAACTCGACACTGGGTGGTTAGTGGCTACGATATGAAAAAATG
ACAAATAAAATCGTAAAACATATGAACCAAAATATATAATCAAAGATTATACAGTCTTAGGCGGCTTTCGAAATTCAGCTAATTTTTTTATTATTGGATAAACCTATGAAAATTGTTTAA
CAAAAAAAAATCATTTTGGAACATTAATGTTTTATTGTAATGTTTTAGACTTTTAGTTAATGATATGAAATGGACATTGGTGAAACAGATCGAAAACCTGGAGATGTTGCTATTACAAGC
ACCGAACCAGTCGGTGCGGATGGGAGACAGCAGGATACTTAGTCAGATGCTAAGTCAGAAGCTGAAACCGGCAAAAGAGAGCAACCCTTTAGTGAGATGGTCGGAGAAAATCAAATATTT
CATACTTGACAATTGGCAGAGACTATGGATCATGATGCTATGGCTTGGCATATGCGGCGGCCTCTTTACTTACAAGTTCATTCAGTACAAGAAGAACAAAGCTGCGTATGATGTGATGGG
TTATTGTGTTTGTGTCGCCAAGGGAGGCGCGGAGACTCTTAAATTCAACATGGCTCTCATATTGCTGCCTGTTTGTCGTAACACCATCACTTGGCTTAGGAACAAGACTAAGCTAGGTAC
TGTCGTTCCGTTTGATGATAATCTTAACTTCCATAAGGTTATTGCAAGCGGGATTGTGGTCGGGGTTTTGCTCCATGCGGGAGCGCATTTAACATGTGATTTCCCGCGTTTAATTGCCGC
GGATGAGGAAACCTATGAGCCAATGGAAAAATACTTTGGGGAGCAACCGGAGAATTACTGGTGGTTTGTGAAGGGTGTGGAAGGATGGACTGGCATTGTGATGGTTGTGCTAATGGCTAT
AGCCTTTACACTCGCTACGCCTTGGTTCCGTCGTAACAAGCTTAACTTACCTAAATTCCTCAAGAAGCTTACCGGTTTCAACGCCTTTTGGTACTCCCACCATTTGTTCATCATTGTTTA
TGCTCTTCTCATTGTCCACGGTATCAAGCTCTACCTCACAAAGATTTGGTATCATAAAACG
GTACGCTCTTCAAATCATTTTCTATGTTTTCTTCTTTAATTTCTTTCATTTTTCGGGTT
AATAACACTTCGTGTTTATATGATGATTCTTGTAGACATGGATGTATCTTGCGGTACCCATCCTTCTATATGCATCTGAGAGGCTGCTCCGTGCTTTCAGATCAAGTATCAAACCGGTTA
AGATGCTCAAG
GTCAGATATATTTCTATTTATCTCTTGAAGACCTTAGGTTTAAATAAAGAGTAAAAAAACAAAAAATTTTATAAATCTTTCAACTAATACCTTTCTTTTTTAATAAAAG
TAGGAAAATTACCTTTGAACTTAATCCTTATTTATGTAACAATAGGTGGCTGTTTACCCCGGGAATGTATTGTCTCTACACATGACGAAGCCACAAGGATTCAAATACAAAAGTGGACAG
TACATGTTCGTGAACTGCCGAGCCGTATCTCCTTTCGAATGGCATCCTTTCTCCATCACATCCGCTCCCGGAGACGATTACCTAAGCGTACACATCCGCACTCTCGGTGACTGGACACGT
AAGCTCAGGACCGTTTTCTCCGAGGTGTGCAAACCTCCTACTGCCGGTAAAAGTGGTCTACTCCGAGCAGACGGAGGAGATGGGAACCTCCCGTTCCCCAAGGTCCTTATCGACGGTCCA
TACGGTGCTCCCGCGCAAGACTACAAGAAATACGACGTGGTACTCCTCGTAGGTCTCGGCATTGGAGCCACGCCTATGATCAGCATCCTTAAGGACATCATCAACAACATGAAATCTCCT
GACAGTGACATCGAGAATAACAACAGTAACAACAACAGTAAAGGGTTCAAGACGAGGAAGGCTTACTTCTACTGGGTGACAAGAGAACAAGGATCGTTCGAGTGGTTCAAGGGAATAATG
GACGAGGTTTCGGAGTTAGACGAGGAAGGAATTATCGAGCTTCACAATTATTGCACGAGTGTGTACGAGGAAGGCGATGCTAGAGTGGCTCTCATTGCCATGCTTCAGTCGTTGCAACAT
GCTAAGAACGGTGTCGATGTTGTGTCGGGGACACGTGTCAAGTCCCACTTTGCTAAACCTAACTGGAGACAAGTCTACAAGAAAATCGCAGTTCAACATCCCGGCAAAAGAATCG
GTAAA
CTAATCTCGACCATTAATCTCGTTATGTACGTGATAATGTATAATAATGATAATGTATAATAAAGTAATGAATTTGGATTAAATACTAATATGAGTTTTCATTGCAGGAGTCTTCTACTG
TGGTGCACCAGGATTGACAAAGGAATTAAAAAATCTAGCTTTGGATTTCTCTCGAAAGACAACTACCAAGTTTGACTTCCACAAAGAGAACTTTTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGAAAATGAGACGAGGCAATTCAAGTACCGACCATGAACTTGGGATTCTACGAGGAGCTAACTCGGATACCAACTCGGATACTGAAAGCATCGCTAGCGACCGCGGCGCCTTCAGTGGTC
CGCTTGGTCGGCCTAAACGTGCGTCCAAGAAAAACGCAAGATTCGCCGACGATCTTCCCAAGAGAAGCAACAGTGTTGCTGGCGGCCGCGGTGACGACGATGAGTACGTGGAGATCACGC
TAGACATTAGGGACGACTCCGTGGCCGTCCACAGTGTCCAACAAGCAGCTGGAGGAGGAGCCCACCTAGAGGACCCGGAGCTAGCCCTTCTCACGAAGAAGACACTCGAGAGCAGCCTCA
ACAACACCACCTCCTTATCATTTTTCCGAAGCACCTCCTCACGAATCAAGAACGCCTCCCGCGAGCTCCGCCGTGTGTTCTCTAGACGTCCCTCCCCGGCCGTGCGGCGGTTTGACCGCA
CCAGCTCCGCGGCCATCCACGCTCTCAAAGGTCTAAAGTTCATCGCCACAAAGACTGCCGCGTGGCCTGCCGTCGACCAACGCTTCGATAAACTCTCCGCTGATTCCAACGGCTTCTTAC
TCTCATCCAAGTTTTGGGAATGCTTAG
GAATGAACAAGGAATCGAAAGACTTCGCAGACCAACTCTTTAGAGCATTAGCTCGCCGGAATAACATCTCCGGCGATGCAATCACAAAGGAAC
AGCTCAGGATATTTTGGGAGCAGATCTCAGACGAAAGCTTTGATGCAAAACTACAAGTCTTTTTTGATAT
GGTGGACAAAGATGAAGATGGGCGAGTAACAGAAGAAGAGGTGGCTGAGA
TTATTAGTCTCAGTGCTTCAGCGAACAAGCTCTCTAATATTCAAAAGCAAGCCAAAGAATATGCGGCACTGATAATGGAAGAGTTGGACCCAGACAATGCTGGGTTTATTATG
ATCGAAA
ACCTGGAGATGTTGCTATTACAAGCACCGAACCAGTCGGTGCGGATGGGAGACAGCAGGATACTTAGTCAGATGCTAAGTCAGAAGCTGAAACCGGCAAAAGAGAGCAACCCTTTAGTGA
GATGGTCGGAGAAAATCAAATATTTCATACTTGACAATTGGCAGAGACTATGGATCATGATGCTATGGCTTGGCATATGCGGCGGCCTCTTTACTTACAAGTTCATTCAGTACAAGAAGA
ACAAAGCTGCGTATGATGTGATGGGTTATTGTGTTTGTGTCGCCAAGGGAGGCGCGGAGACTCTTAAATTCAACATGGCTCTCATATTGCTGCCTGTTTGTCGTAACACCATCACTTGGC
TTAGGAACAAGACTAAGCTAGGTACTGTCGTTCCGTTTGATGATAATCTTAACTTCCATAAGGTTATTGCAAGCGGGATTGTGGTCGGGGTTTTGCTCCATGCGGGAGCGCATTTAACAT
GTGATTTCCCGCGTTTAATTGCCGCGGATGAGGAAACCTATGAGCCAATGGAAAAATACTTTGGGGAGCAACCGGAGAATTACTGGTGGTTTGTGAAGGGTGTGGAAGGATGGACTGGCA
TTGTGATGGTTGTGCTAATGGCTATAGCCTTTACACTCGCTACGCCTTGGTTCCGTCGTAACAAGCTTAACTTACCTAAATTCCTCAAGAAGCTTACCGGTTTCAACGCCTTTTGGTACT
CCCACCATTTGTTCATCATTGTTTATGCTCTTCTCATTGTCCACGGTATCAAGCTCTACCTCACAAAGATTTGGTATCATAAAACG
ACATGGATGTATCTTGCGGTACCCATCCTTCTAT
ATGCATCTGAGAGGCTGCTCCGTGCTTTCAGATCAAGTATCAAACCGGTTAAGATGCTCAAG
GTGGCTGTTTACCCCGGGAATGTATTGTCTCTACACATGACGAAGCCACAAGGATTCA
AATACAAAAGTGGACAGTACATGTTCGTGAACTGCCGAGCCGTATCTCCTTTCGAATGGCATCCTTTCTCCATCACATCCGCTCCCGGAGACGATTACCTAAGCGTACACATCCGCACTC
TCGGTGACTGGACACGTAAGCTCAGGACCGTTTTCTCCGAGGTGTGCAAACCTCCTACTGCCGGTAAAAGTGGTCTACTCCGAGCAGACGGAGGAGATGGGAACCTCCCGTTCCCCAAGG
TCCTTATCGACGGTCCATACGGTGCTCCCGCGCAAGACTACAAGAAATACGACGTGGTACTCCTCGTAGGTCTCGGCATTGGAGCCACGCCTATGATCAGCATCCTTAAGGACATCATCA
ACAACATGAAATCTCCTGACAGTGACATCGAGAATAACAACAGTAACAACAACAGTAAAGGGTTCAAGACGAGGAAGGCTTACTTCTACTGGGTGACAAGAGAACAAGGATCGTTCGAGT
GGTTCAAGGGAATAATGGACGAGGTTTCGGAGTTAGACGAGGAAGGAATTATCGAGCTTCACAATTATTGCACGAGTGTGTACGAGGAAGGCGATGCTAGAGTGGCTCTCATTGCCATGC
TTCAGTCGTTGCAACATGCTAAGAACGGTGTCGATGTTGTGTCGGGGACACGTGTCAAGTCCCACTTTGCTAAACCTAACTGGAGACAAGTCTACAAGAAAATCGCAGTTCAACATCCCG
GCAAAAGAATCG
GAGTCTTCTACTGTGGTGCACCAGGATTGACAAAGGAATTAAAAAATCTAGCTTTGGATTTCTCTCGAAAGACAACTACCAAGTTTGACTTCCACAAAGAGAACTTTT
AG

Retrieve as FASTA