Entry information : AbKat01_bisporus
Entry ID 7590
Creation 2010-08-17 (Christophe Dunand)
Last sequence changes 2010-08-17 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-04-10 (Christophe Dunand)
Peroxidase information: AbKat01_bisporus
Name AbKat01_bisporus
Class Catalase    [Orthogroup: Kat001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Agaricaceae Agaricus
Organism Agaricus bisporus    [TaxId: 5341 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AbKat01_bisporus
start..stop
S start..stop
LbiKat01 888 0 8..514 14..520
PscKat01 849 0 8..515 14..522
CcinKat01 845 0 8..514 14..520
SlutKat01 785 0 8..515 14..521
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 463420..463525 106 N° 2 463310..463368 59 N° 3 462908..463237 330 N° 4 462673..462852 180
N° 5 462509..462622 114 N° 6 462303..462452 150 N° 7 461894..462242 349 N° 8 461715..461840 126
N° 9 461504..461649 146  
complement(join(461504..461649,461715..461840,461894..462242,462303..462452,4625 09..462622,462673..462852,462908..463237,463310..463368,463420..463525))


exon

Literature and cross-references AbKat01_bisporus
DNA ref. JGI genome:   scaffold_12 (463525..461504)
Protein sequence: AbKat01_bisporus
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   519
PWM (Da):   %s   58538.92  
PI (pH):   %s   6.94
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSSPAKPVYTTSNGAPVNEPYSAQRAGFHGPLLLQDFHHIDLLAHFDRERIPERVHAKAAGAHGYFQVTHDLSDITSQSLFQGVGKKVRITARFSTVGGESGSADTARDPRGFAIKLRTEEGNWDWVFNNTPIFFIRDPAKFAHFIHTQKRNPQTHLKDPDAFWDYLGQNPESIHQMMILFSDRGTPDGFYQEHGYSGHTFKWCKADGSFVYVQVTCRADGGFKTLDDATATRLSGENPDYGTQQMFEAIEAGNFPSWTVYIQTMTPAQAEQFRYNILDLTKVWPHKEFPLRPIGKMVLNENPQNYFAEIEQVAFSPSHLVPYIEPSADPVLQSRLFSYPDTHRHRLGANYQQLPVNAPIVPVANFQRDGPMAFVNQGNRPNYQCSFQPLTYAGRPGHMDASVNDRERDARHENFINGAWRYLSVISELDFEQPRELWSRVWNDQERETYVKNVSGHFKNVKSAEVKARQLSVWAAVDQGLSDRIADAVGHPHVAPLKCISAAEVLNFRHNIGAGSNQ

Retrieve as FASTA  
Remarks Complete sequence from genomic (8 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCTTCTCCAGCTAAGCCCGTCTATACTACCTCCAACGGTGCCCCCGTTAACGAGCCATACTCGGCTCAGAGGGCTGGTTTCCATGGACCCCTTCTCCTCCAAGGTCTGTGTCTTCCT
TTCCGACCATTAATCTCATCTTCTGATCGATGATTAGATTTCCATCATATCGACCTCCTCGCTCACTTTGATCGCGAGCGTATTCCTGAGCGTGTTGTAAGTACCCTTCGATACATTCGA
TCGCTTATCTATCCGATCAACGACATCATTTATATGTCTCTCATGTAGGTCCACGCCAAGGCTGCCGGTGCTCACGGCTACTTCCAAGTCACTCACGATTTGAGTGATATCACCTCTCAG
TCCCTCTTCCAAGGTGTTGGCAAAAAAGTCCGCATCACTGCCCGCTTCTCCACTGTCGGTGGTGAATCCGGTTCAGCGGATACCGCTCGTGATCCCCGTGGCTTTGCTATCAAGCTGAGA
ACTGAGGAAGGTAACTGGGATTGGGTGTTTAACAACACTCCCATCTTCTTTATTCGTGATCCTGCCAAGTTTGCCCACTTTATCCATACACAAAAGAGGAATCCTCAGACTCACTTGAAG
GATCCTGATGCTTTCTGG
GTAGGTTTTCTCAAGAGCTTGTGTCCGTGTTGGCGATTGATCAATTGGTGTTCAGGACTATCTCGGTCAAAATCCCGAGTCTATTCATCAGATGATGATTCT
CTTCTCCGATCGCGGAACCCCTGACGGCTTCTACCAAGAGCATGGTTATTCTGGCCATACCTTCAAGTGGTGCAAGGCCGACGGCTCTTTCGTCTACGTTCAAGTTACTTGCAGAGCTGA
TGGAGGCTTCAAG
GTAGGTCAAACTCCGTTTTTTTATGACTGGAGCTGAGAACTTTTTCAAAGACTCTTGATGATGCTACTGCCACCCGTCTGTCTGGAGAAAACCCAGACTACGGTACC
CAGCAAATGTTCGAGGCGATCGAAGCAGGAAATTTCCCCTCCTGGACTGTTTATATC
GTGAGTCTTCGTGGCGGTCTTATGATACCTCAATAATAACAAAATTTCCCCAACAGCAAACCA
TGACGCCTGCTCAAGCTGAACAGTTCCGTTACAATATCCTCGATTTGACCAAAGTTTGGCCTCACAAGGAATTCCCTCTCCGTCCCATTGGTAAAATGGTTCTCAACGAGAACCCGCAAA
ACTACTTTGCCGAGATTGAACAA
GTGCGCATCATTCGAATTTGCAGATGTCCAGAAATACTGATTCAGTGTCATTCTTTTTAGGTCGCATTCTCACCTTCTCACCTTGTTCCTTACATCG
AGCCCTCTGCCGACCCCGTTCTTCAGTCCCGTCTCTTCTCCTACCCGGATACTCACCGTCATCGCCTGGGTGCTAACTACCAGCAACTTCCTGTCAATGCTCCCATCGTCCCTGTTGCCA
ACTTCCAGCGCGATGGCCCCATGGCGTTTGTTAACCAGGGCAACAGGCCTAACTACCAATGCTCATTCCAACCTTTGACGTACGCTGGAAGGCCAGGTCATATGGACGCTTCTGTCAATG
ACCGAGAACGGGATGCTAGACACGAGAACTTTATCAATGGTGCTTGGAGGTATTTGAGTGTTATCAGCGAGC
GTGAGTGTTTATATTATTACTATTTCTGATTATTGTGAATTGATGGTT
TGTAGTCGACTTTGAACAGCCTCGTGAACTTTGGTCTAGGGTTTGGAATGATCAGGAACGTGAAACTTATGTCAAGAACGTATCTGGTCACTTTAAAAACGTCAAGAGCGCCGAGGTCAA
GGCTAGGCAAT
GTAAGTCTCCCCCACCAAAGCAAGGGAAATCGTTCGTGGAACTGATGATGGCGGTTTCTTATTAGTGTCTGTTTGGGCTGCTGTCGACCAAGGTCTTTCTGACCGTATT
GCCGATGCAGTTGGTCACCCCCACGTTGCACCCCTCAAGTGCATCTCTGCTGCTGAGGTCTTGAACTTTAGGCACAATATTGGTGCAGGCTCTAACCAGTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCTTCTCCAGCTAAGCCCGTCTATACTACCTCCAACGGTGCCCCCGTTAACGAGCCATACTCGGCTCAGAGGGCTGGTTTCCATGGACCCCTTCTCCTCCAAGATTTCCATCATATC
GACCTCCTCGCTCACTTTGATCGCGAGCGTATTCCTGAGCGTGTT
GTCCACGCCAAGGCTGCCGGTGCTCACGGCTACTTCCAAGTCACTCACGATTTGAGTGATATCACCTCTCAGTCC
CTCTTCCAAGGTGTTGGCAAAAAAGTCCGCATCACTGCCCGCTTCTCCACTGTCGGTGGTGAATCCGGTTCAGCGGATACCGCTCGTGATCCCCGTGGCTTTGCTATCAAGCTGAGAACT
GAGGAAGGTAACTGGGATTGGGTGTTTAACAACACTCCCATCTTCTTTATTCGTGATCCTGCCAAGTTTGCCCACTTTATCCATACACAAAAGAGGAATCCTCAGACTCACTTGAAGGAT
CCTGATGCTTTCTGG
GACTATCTCGGTCAAAATCCCGAGTCTATTCATCAGATGATGATTCTCTTCTCCGATCGCGGAACCCCTGACGGCTTCTACCAAGAGCATGGTTATTCTGGCCAT
ACCTTCAAGTGGTGCAAGGCCGACGGCTCTTTCGTCTACGTTCAAGTTACTTGCAGAGCTGATGGAGGCTTCAAG
ACTCTTGATGATGCTACTGCCACCCGTCTGTCTGGAGAAAACCCA
GACTACGGTACCCAGCAAATGTTCGAGGCGATCGAAGCAGGAAATTTCCCCTCCTGGACTGTTTATATC
CAAACCATGACGCCTGCTCAAGCTGAACAGTTCCGTTACAATATCCTCGAT
TTGACCAAAGTTTGGCCTCACAAGGAATTCCCTCTCCGTCCCATTGGTAAAATGGTTCTCAACGAGAACCCGCAAAACTACTTTGCCGAGATTGAACAA
GTCGCATTCTCACCTTCTCAC
CTTGTTCCTTACATCGAGCCCTCTGCCGACCCCGTTCTTCAGTCCCGTCTCTTCTCCTACCCGGATACTCACCGTCATCGCCTGGGTGCTAACTACCAGCAACTTCCTGTCAATGCTCCC
ATCGTCCCTGTTGCCAACTTCCAGCGCGATGGCCCCATGGCGTTTGTTAACCAGGGCAACAGGCCTAACTACCAATGCTCATTCCAACCTTTGACGTACGCTGGAAGGCCAGGTCATATG
GACGCTTCTGTCAATGACCGAGAACGGGATGCTAGACACGAGAACTTTATCAATGGTGCTTGGAGGTATTTGAGTGTTATCAGCGAGC
TCGACTTTGAACAGCCTCGTGAACTTTGGTCT
AGGGTTTGGAATGATCAGGAACGTGAAACTTATGTCAAGAACGTATCTGGTCACTTTAAAAACGTCAAGAGCGCCGAGGTCAAGGCTAGGCAAT
TGTCTGTTTGGGCTGCTGTCGACCAA
GGTCTTTCTGACCGTATTGCCGATGCAGTTGGTCACCCCCACGTTGCACCCCTCAAGTGCATCTCTGCTGCTGAGGTCTTGAACTTTAGGCACAATATTGGTGCAGGCTCTAACCAGTGA

Retrieve as FASTA