Entry information : AbKat02_bisporus
Entry ID 7591
Creation 2010-08-17 (Christophe Dunand)
Last sequence changes 2010-08-17 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-04-10 (Christophe Dunand)
Peroxidase information: AbKat02_bisporus
Name AbKat02_bisporus
Class Catalase    [Orthogroup: Kat001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Agaricaceae Agaricus
Organism Agaricus bisporus    [TaxId: 5341 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AbKat02_bisporus
start..stop
S start..stop
AbKat03_bisporus 1191 0 12..742 12..746
PplKat03 1090 0 1..742 1..743
CcinKat02 1083 0 1..726 1..721
PcKat04 1082 0 3..742 2..740
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 2318488..2318639 152 N° 2 2318694..2318952 259 N° 3 2319002..2319218 217 N° 4 2319277..2319312 36
N° 5 2319364..2319528 165 N° 6 2319587..2319927 341 N° 7 2319977..2320125 149 N° 8 2320178..2320836 659
N° 9 2320892..2321142 251  
join(2318488..2318639,2318694..2318952,2319002..2319218,2319277..2319312,2319364 ..2319528,2319587..2319927,2319977..2320125,2320178..2320836,2320892..2321142)


exon

Literature and cross-references AbKat02_bisporus
DNA ref. JGI genome:   scaffold_2 (2318488..2321142)
Protein sequence: AbKat02_bisporus
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   742
PWM (Da):   %s   82884.49  
PI (pH):   %s   6.63
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSSAAQTAMDNVSRISDNPKLRDLKNATNDLTNESGLTTDHGVKVPDTDNWLKVSDGQHNGPSLLEDQIAREKIHRFDHERIPERVVHARGFGAHGHFRAVNDGASKYTFAPVLTDTSRETPIFIRFSTVAGSRGSDTVRDVRGFAMKFYTPEGNWDLVGNDIPVFFIQDAIKFPDIIHAVKPEPHNEIPQAQSAHNNFWDFTGLQPESAHMVCWVMSDRGIPRSYRMMQGFGVNTYTLINKNGERHFVKFHMTPELGVHSLVWDEALKICGEDPDFHRKDLNEAIENGCPPKWTFGIQVIEEKDEHNFDFDILDATKLWPEELVPVQPIGEFVLDRTVDEFFPETEQVAFCTSHVVPGIGFSDDPLLQGRNFSYFDTQISRLGINWELPINRPTCPVLNHHRDGKMNHHINTNNLNYYPNRKDVCHPVPTSEGSYMEFKNKTEGMKQRVRGAKFQEHFNQAQLFYNSLAPHEKAHLIDAMSFELSHCDDLDVPRTYTKLLNNIDFDLAKAVATNVNGIIPEKPARPNHGKKSAALSQDHFLPKTPTIATRRIAILIADNFNYTDVQAIRASLASAKATTWIIGPRRGDVVAESQLGGTVDPKITADHHFEGQRSTLFDAIFVPGGAHAKSLSKNGRAIHWVREAFGHCKAIGAIGGAAFLKHAINLPEVEIVSDVSKPEVVVSYGVVTIGKYSAGSAAKDVIRLDPSSEGFASRFGYEISKHRCWQRELDGLTKQVAY

Retrieve as FASTA  
Remarks Complete sequence from genomic (8 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCATCTGCTGCTCAGACCGCCATGGATAATGTTTCGAGAATTTCCGACAATCCTAAGCTACGAGATTTGAAAAATGCCACCAATGACCTCACCAACGAAAGCGGTTTGACCACCGAT
CATGGCGTCAAAGTCCCTGACACCGATAACTG
GTACATTTCTCCTAAAGTTGGATTTTCGACATATTCTCATCTATGGACTGATAGGCTCAAAGTTTCCGACGGGCAGCACAATGGACCC
TCTCTACTTGAGGATCAGATTGCTCGAGAAAAAATACATCGGTTCGATCACGAACGCATTCCCGAGCGAGTTGTTCATGCCCGTGGTTTTGGAGCTCATGGTCATTTTCGAGCTGTTAAT
GACGGTGCTTCAAAATACACGTTCGCACCGGTTCTAACGGATACGTCGAGGGAAACACCCATTTTCATCAGGTTCAGCACAGTGGCAGGCTCACGGGGGAGTGCG
GTTAGTATATGCGCT
AGCTTCGACTTGGCGAGATTCACATGCTTCATAGGATACCGTCAGGGATGTTCGCGGCTTCGCGATGAAGTTCTATACCCCTGAGGGTAATTGGGATCTTGTCGGCAATGATATTCCCGT
TTTTTTTATCCAAGATGCAATCAAATTTCCGGATATCATTCATGCAGTCAAGCCCGAGCCGCACAATGAAATTCCCCAGGCCCAGTCTGCACATAATAATTTTTGGGACTTTACTGGCCT
CCAGCCTGAAT
GTTCGTGCACTCTTTCATACTTTGTCTGAGGCAGCAGCGCTTACGAAATTGACTTTAGCTGCGCATATGGTTTGTTGGGTCATGTCCGATCGAGGTCAGTCATAATATC
ACTTCGTATTTTCTGATTAACTGATACGAAAGTCAGGCATTCCCCGTTCGTACCGCATGATGCAAGGATTTGGGGTTAATACATATACTCTCATTAATAAGAATGGGGAACGGCACTTTG
TCAAATTCCATATGACACCAGAATTAGGGGTTCACAGTCTGGTCTGGGACGAAGCACTGAAAATCTGCGGAGAAGATCCCG
GTCAGCTGTATTTCACTCGTAATGCTGTGTATCGCTGCT
AATTTTTTACTACTCTCAGATTTTCACAGAAAGGATCTTAATGAGGCCATTGAAAACGGATGTCCACCAAAATGGACCTTCGGAATCCAGGTTATTGAAGAAAAGGATGAGCATAACTTT
GATTTCGATATCCTCGATGCTACCAAACTTTGGCCTGAGGAGCTCGTTCCCGTTCAGCCAATTGGGGAGTTCGTTCTTGATCGTACGGTTGACGAGTTTTTCCCTGAGACCGAGCAAGTT
GCATTCTGCACGAGTCACGTCGTGCCTGGAATAGGCTTTAGTGACGATCCGCTCCTTCAAGGCAGGAATTTCTCGTACTTTGATACACAAATATCCCGACTGGGTATTAATTGGGAACAG
GTAAGTCTTCCGTATGCACTAGATTTTATATTCCTAATTCCCTTTATAGTTACCCATCAACCGACCCACCTGCCCCGTTCTTAATCATCACCGTGACGGGAAGATGAACCACCACATAAA
CACCAATAATTTGAACTATTATCCCAATCGGAAGGATGTTTGCCATCCTGTTCCCACTTCGGAAGGTAGTTATATGGA
GTGAGTTTGATCCTTCCCCCACACGAGCTTTGTCACGACTCA
TATGCCTTAGATTCAAGAACAAGACTGAAGGCATGAAGCAGCGAGTCCGCGGAGCGAAGTTCCAGGAACACTTCAATCAGGCCCAACTTTTCTATAATTCGCTTGCACCGCATGAAAAAG
CTCATCTCATCGATGCCATGTCTTTTGAACTCAGCCACTGCGATGATCTTGATGTTCCCAGAACGTATACAAAGCTCTTAAATAACATCGATTTCGATCTTGCGAAGGCAGTCGCAACTA
ACGTCAATGGTATCATACCAGAGAAACCCGCGCGCCCTAACCACGGGAAAAAATCTGCTGCCCTTTCGCAAGATCATTTCCTGCCAAAAACGCCCACAATTGCAACCCGTAGGATCGCGA
TACTCATTGCGGACAACTTCAACTATACCGACGTCCAAGCAATTCGTGCCTCTCTAGCTAGTGCTAAGGCTACGACCTGGATCATCGGACCTCGGCGCGGTGACGTTGTTGCGGAAAGTC
AACTTGGCGGAACTGTAGACCCAAAGATCACAGCAGATCATCATTTCGAGGGTCAGAGATCGACGCTCTTTGACGCGATATTCGTACCCGGTGGGGCTCATGCCAAGTCCCTGTCAAAAA
ACGGCCGCGCCATACACTGGGTTAGGGAAGCTTTTGGTCATTGCAAGGCTATTGGTGCGATCGGCGACG
GTACGTTTTCACATTCTGGAATCACATAACATTAATTAAACTGTGCTTTCT
ACAGGTGCCGCGTTTTTGAAGCACGCCATCAACCTTCCCGAGGTAGAGATTGTCTCCGACGTCTCTAAGCCTGAAGTTGTCGTTTCTTACGGTGTTGTTACTATTGGCAAATATTCCGCC
GGTTCGGCGGCCAAGGATGTCATCCGCCTTGATCCCAGCTCTGAAGGATTTGCGTCACGCTTTGGCTATGAGATCAGCAAGCACAGATGTTGGCAACGAGAGCTGGATGGTTTGACGAAA
CAAGTGGCGTACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCATCTGCTGCTCAGACCGCCATGGATAATGTTTCGAGAATTTCCGACAATCCTAAGCTACGAGATTTGAAAAATGCCACCAATGACCTCACCAACGAAAGCGGTTTGACCACCGAT
CATGGCGTCAAAGTCCCTGACACCGATAACTG
GCTCAAAGTTTCCGACGGGCAGCACAATGGACCCTCTCTACTTGAGGATCAGATTGCTCGAGAAAAAATACATCGGTTCGATCACGAA
CGCATTCCCGAGCGAGTTGTTCATGCCCGTGGTTTTGGAGCTCATGGTCATTTTCGAGCTGTTAATGACGGTGCTTCAAAATACACGTTCGCACCGGTTCTAACGGATACGTCGAGGGAA
ACACCCATTTTCATCAGGTTCAGCACAGTGGCAGGCTCACGGGGGAGTGCG
GATACCGTCAGGGATGTTCGCGGCTTCGCGATGAAGTTCTATACCCCTGAGGGTAATTGGGATCTTGTC
GGCAATGATATTCCCGTTTTTTTTATCCAAGATGCAATCAAATTTCCGGATATCATTCATGCAGTCAAGCCCGAGCCGCACAATGAAATTCCCCAGGCCCAGTCTGCACATAATAATTTT
TGGGACTTTACTGGCCTCCAGCCTGAAT
CTGCGCATATGGTTTGTTGGGTCATGTCCGATCGAGGCATTCCCCGTTCGTACCGCATGATGCAAGGATTTGGGGTTAATACATATACTCTC
ATTAATAAGAATGGGGAACGGCACTTTGTCAAATTCCATATGACACCAGAATTAGGGGTTCACAGTCTGGTCTGGGACGAAGCACTGAAAATCTGCGGAGAAGATCCCG
ATTTTCACAGA
AAGGATCTTAATGAGGCCATTGAAAACGGATGTCCACCAAAATGGACCTTCGGAATCCAGGTTATTGAAGAAAAGGATGAGCATAACTTTGATTTCGATATCCTCGATGCTACCAAACTT
TGGCCTGAGGAGCTCGTTCCCGTTCAGCCAATTGGGGAGTTCGTTCTTGATCGTACGGTTGACGAGTTTTTCCCTGAGACCGAGCAAGTTGCATTCTGCACGAGTCACGTCGTGCCTGGA
ATAGGCTTTAGTGACGATCCGCTCCTTCAAGGCAGGAATTTCTCGTACTTTGATACACAAATATCCCGACTGGGTATTAATTGGGAACAG
TTACCCATCAACCGACCCACCTGCCCCGTT
CTTAATCATCACCGTGACGGGAAGATGAACCACCACATAAACACCAATAATTTGAACTATTATCCCAATCGGAAGGATGTTTGCCATCCTGTTCCCACTTCGGAAGGTAGTTATATGGA
A
TTCAAGAACAAGACTGAAGGCATGAAGCAGCGAGTCCGCGGAGCGAAGTTCCAGGAACACTTCAATCAGGCCCAACTTTTCTATAATTCGCTTGCACCGCATGAAAAAGCTCATCTCATC
GATGCCATGTCTTTTGAACTCAGCCACTGCGATGATCTTGATGTTCCCAGAACGTATACAAAGCTCTTAAATAACATCGATTTCGATCTTGCGAAGGCAGTCGCAACTAACGTCAATGGT
ATCATACCAGAGAAACCCGCGCGCCCTAACCACGGGAAAAAATCTGCTGCCCTTTCGCAAGATCATTTCCTGCCAAAAACGCCCACAATTGCAACCCGTAGGATCGCGATACTCATTGCG
GACAACTTCAACTATACCGACGTCCAAGCAATTCGTGCCTCTCTAGCTAGTGCTAAGGCTACGACCTGGATCATCGGACCTCGGCGCGGTGACGTTGTTGCGGAAAGTCAACTTGGCGGA
ACTGTAGACCCAAAGATCACAGCAGATCATCATTTCGAGGGTCAGAGATCGACGCTCTTTGACGCGATATTCGTACCCGGTGGGGCTCATGCCAAGTCCCTGTCAAAAAACGGCCGCGCC
ATACACTGGGTTAGGGAAGCTTTTGGTCATTGCAAGGCTATTGGTGCGATCGGCGACG
GTGCCGCGTTTTTGAAGCACGCCATCAACCTTCCCGAGGTAGAGATTGTCTCCGACGTCTCT
AAGCCTGAAGTTGTCGTTTCTTACGGTGTTGTTACTATTGGCAAATATTCCGCCGGTTCGGCGGCCAAGGATGTCATCCGCCTTGATCCCAGCTCTGAAGGATTTGCGTCACGCTTTGGC
TATGAGATCAGCAAGCACAGATGTTGGCAACGAGAGCTGGATGGTTTGACGAAACAAGTGGCGTACTAA

Retrieve as FASTA