Entry information : AbKat03_bisporus
Entry ID 7592
Creation 2010-08-17 (Christophe Dunand)
Last sequence changes 2010-08-17 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-04-10 (Christophe Dunand)
Peroxidase information: AbKat03_bisporus
Name AbKat03_bisporus
Class Catalase    [Orthogroup: Kat001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Agaricaceae Agaricus
Organism Agaricus bisporus    [TaxId: 5341 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AbKat03_bisporus
start..stop
S start..stop
AbKat02_bisporus 1200 0 1..746 1..742
PplKat03 1070 0 2..746 3..743
CcinKat02 1053 0 1..730 1..721
PcKat04 1047 0 7..746 6..740
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 2314584..2314735 152 N° 2 2314789..2315047 259 N° 3 2315102..2315318 217 N° 4 2315375..2315410 36
N° 5 2315459..2315623 165 N° 6 2315673..2316013 341 N° 7 2316066..2316223 158 N° 8 2316273..2316934 662
N° 9 2316984..2317234 251  
join(2314584..2314735,2314789..2315047,2315102..2315318,2315375..2315410,2315459 ..2315623,2315673..2316013,2316066..2316223,2316273..2316934,2316984..2317234)


exon

Literature and cross-references AbKat03_bisporus
DNA ref. JGI genome:   scaffold_2 (2314584..2317234)
Protein sequence: AbKat03_bisporus
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   195
PWM (Da):   %s   21373.71  
PI (pH):   %s   6.5
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAAFAQAATKAVSKVTYDAKTSDLKNVTVDCSGDTGLTTDHGVKIPDTDNWLKISDGEHSGPLLLEDQISREKLHRFDHERIPERVVHARGFGAHGHFKVYDDSASKFTFAPVLTDSTRNTPILIRFSPAQGSRGSDTVRDVRGFAMKFYTPEGIWDLVGNDIPVFFIQDAVKFPDFVHALKPEPHNEVPQGQTAHNNFWDFVGLMPESAHMVCWVMSDRGIPRSYRMMQGFGVNTFTLINDQGEQSFVKFHMIPELGVHSLVWDEALKINGEDPDFHRKDLNEAIENGCPPKWTFGIQVIEEKDEHNFDFDILDATKVWPEELVPVQIIGEFVLDRTVDEVFPELEQVAFCTSHVVPGIGFSDDPLLQGRNFSYFDTQINRLGINWELPINRPTCPIFNHNRDGAMNSRINANELNYYPNRENRGHPIAPNRTSGGGYVDFQEKVQGIKQRVRGAKFQEHFNQAQLFYNSLKPHEKGHLIRAFSFELDHCDDERVYKTYTELLRNIDLDLAKTVAENVGGIAPDSPARPNHGKIAPSLSQDYFMPPAPTIATRRVAILIADGFNYIEVQTMRGLLAMAKATCWIIGPRRGEVKSESQISGVEGMTINADHHYEGQRSTLFDAIFVPSGPKHAEALMQNGRAIHWIREAFGHCKAISAIGGVAFLKHAIQLPEVDLELNLDVGKVTTSYGVVTTGKYSVISAAAETFTFGPNDEGFESSFAYEISKHRCWDRELDGLTERVAF

Retrieve as FASTA  
Remarks Complete sequence from genomic
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTGCCTTTGCCCAAGCCGCTACGAAAGCTGTTTCAAAAGTTACTTATGACGCTAAAACAAGCGATTTGAAGAATGTCACCGTTGATTGCTCCGGCGATACGGGTCTCACCACCGAT
CATGGTGTAAAAATTCCCGACACCGATAATTG
GTCCGTTCCTCTTGATACTACGTTATATATATTTATATCTAACCATGTCAAAGGCTTAAAATTTCCGACGGGGAGCACAGTGGACCTT
TGTTGCTCGAAGATCAGATCAGTCGGGAGAAACTGCATCGTTTCGATCATGAACGTATCCCCGAACGAGTTGTTCACGCTCGTGGTTTTGGAGCTCATGGCCATTTCAAAGTTTATGATG
ACAGTGCCTCAAAATTCACGTTTGCACCTGTCCTAACAGATTCAACGAGAAACACTCCGATTCTCATAAGATTTAGCCCCGCACAGGGCTCCCGTGGCAGTCCG
GTAAGCGATTTGACGA
ATTGTTCATCGTGATATTGTCTCATATGTTCATTGAAGGATACCGTTAGGGATGTTCGTGGGTTTGCGATGAAATTTTATACACCTGAGGGTATCTGGGATTTGGTCGGGAATGATATTC
CTGTATTTTTCATCCAAGACGCTGTCAAGTTCCCGGACTTCGTTCACGCTCTCAAACCTGAGCCACATAACGAAGTCCCACAGGGTCAGACGGCGCATAATAATTTCTGGGACTTTGTCG
GACTTATGCCTGAAT
GTTTGTGGGGCTTTTCCTTCGTATGTGCTGCATCTCTGAAAACGAATATATGTCAGCCGCCCATATGGTTTGTTGGGTCATGTCCGACCGCGGTGAGGTTAATTC
GATATTCGTCTCTACGAAAGCTGATCAGAAACTAGGTATTCCTCGTTCCTATCGTATGATGCAAGGTTTTGGTGTCAATACGTTTACTCTCATCAATGACCAAGGAGAGCAGTCTTTTGT
TAAGTTTCATATGATCCCAGAGTTAGGTGTTCATAGTCTGGTTTGGGACGAAGCGTTAAAGATCAATGGAGAAGATCCCG
GTAAGTTTTTTTTTGATGGCTGCTGAGGTAAAACTCAACT
TGTTTCAAGATTTTCACAGAAAAGATCTCAATGAGGCAATTGAAAATGGATGTCCACCTAAATGGACTTTCGGAATCCAGGTTATTGAAGAGAAGGATGAGCATAATTTTGACTTCGATA
TCCTCGATGCAACAAAGGTGTGGCCCGAGGAACTCGTTCCTGTTCAGATTATAGGAGAATTCGTTCTTGACCGCACGGTCGACGAGGTTTTCCCCGAGTTGGAGCAAGTCGCTTTTTGCA
CGAGCCATGTTGTTCCAGGAATAGGCTTTAGTGATGATCCGCTCCTTCAAGGCCGAAATTTCTCGTATTTCGATACACAGATTAACCGATTGGGTATTAACTGGGAACAA
GTGAGACTCG
CTTGCCTTATCCTCGCAGGTTGTGCGTCTAATTCGTCATTAGCTGCCAATCAATCGGCCAACCTGTCCCATCTTCAACCATAATCGTGATGGGGCAATGAACTCTCGCATCAACGCCAAT
GAATTGAACTACTATCCCAACCGAGAGAATCGCGGTCACCCTATTGCCCCGAATCGCACTTCAGGCGGAGGCTATGTGGA
GTGAGATTTACTTTTTGCCCGTGAGCGAATTGTTAACTGT
CTACTGTAGCTTTCAAGAGAAGGTTCAAGGCATAAAGCAACGCGTTCGTGGAGCCAAGTTTCAGGAACACTTCAATCAGGCTCAACTTTTCTACAATTCCCTCAAGCCGCACGAGAAAGG
TCATCTTATCCGTGCATTCTCTTTCGAGTTGGATCATTGCGATGACGAACGTGTTTATAAAACATATACTGAACTTCTCAGAAACATTGACCTTGACCTCGCCAAGACAGTGGCAGAAAA
CGTTGGCGGAATCGCTCCGGATTCGCCGGCACGCCCCAACCACGGAAAAATAGCGCCGTCACTCTCCCAAGATTATTTTATGCCACCAGCTCCTACTATTGCTACTCGCAGAGTTGCAAT
CCTTATTGCGGACGGGTTCAACTACATAGAGGTTCAAACAATGCGCGGCCTGCTTGCTATGGCCAAAGCCACATGTTGGATCATTGGTCCTCGCCGCGGAGAGGTCAAATCAGAAAGCCA
AATTAGTGGAGTCGAAGGTATGACTATCAATGCGGATCATCATTATGAGGGCCAGAGGTCTACGCTCTTTGATGCTATCTTCGTTCCCTCCGGGCCTAAGCATGCCGAAGCCCTGATGCA
AAACGGCAGAGCGATACATTGGATTAGAGAAGCCTTTGGTCATTGCAAAGCTATTTCTGCCATTGGCGAAG
GTACGTTTTAAAAGACTTTCGAGGATTGCGGTGACTAAGATTTCTGAAG

GGGTCGCATTTTTGAAACATGCCATTCAACTTCCTGAGGTTGACCTAGAATTGAATCTGGACGTTGGTAAAGTCACTACCTCCTACGGCGTTGTTACGACGGGCAAATATTCCGTAATTT
CGGCCGCCGCAGAAACTTTCACATTCGGGCCCAATGATGAAGGGTTTGAATCGAGTTTTGCATATGAGATTAGCAAGCACAGATGCTGGGATAGAGAACTAGACGGTTTGACTGAACGAG
TGGCTTTCTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTGCCTTTGCCCAAGCCGCTACGAAAGCTGTTTCAAAAGTTACTTATGACGCTAAAACAAGCGATTTGAAGAATGTCACCGTTGATTGCTCCGGCGATACGGGTCTCACCACCGAT
CATGGTGTAAAAATTCCCGACACCGATAATTG
GCTTAAAATTTCCGACGGGGAGCACAGTGGACCTTTGTTGCTCGAAGATCAGATCAGTCGGGAGAAACTGCATCGTTTCGATCATGAA
CGTATCCCCGAACGAGTTGTTCACGCTCGTGGTTTTGGAGCTCATGGCCATTTCAAAGTTTATGATGACAGTGCCTCAAAATTCACGTTTGCACCTGTCCTAACAGATTCAACGAGAAAC
ACTCCGATTCTCATAAGATTTAGCCCCGCACAGGGCTCCCGTGGCAGTCCG
GATACCGTTAGGGATGTTCGTGGGTTTGCGATGAAATTTTATACACCTGAGGGTATCTGGGATTTGGTC
GGGAATGATATTCCTGTATTTTTCATCCAAGACGCTGTCAAGTTCCCGGACTTCGTTCACGCTCTCAAACCTGAGCCACATAACGAAGTCCCACAGGGTCAGACGGCGCATAATAATTTC
TGGGACTTTGTCGGACTTATGCCTGAAT
CCGCCCATATGGTTTGTTGGGTCATGTCCGACCGCGGTATTCCTCGTTCCTATCGTATGATGCAAGGTTTTGGTGTCAATACGTTTACTCTC
ATCAATGACCAAGGAGAGCAGTCTTTTGTTAAGTTTCATATGATCCCAGAGTTAGGTGTTCATAGTCTGGTTTGGGACGAAGCGTTAAAGATCAATGGAGAAGATCCCG
ATTTTCACAGA
AAAGATCTCAATGAGGCAATTGAAAATGGATGTCCACCTAAATGGACTTTCGGAATCCAGGTTATTGAAGAGAAGGATGAGCATAATTTTGACTTCGATATCCTCGATGCAACAAAGGTG
TGGCCCGAGGAACTCGTTCCTGTTCAGATTATAGGAGAATTCGTTCTTGACCGCACGGTCGACGAGGTTTTCCCCGAGTTGGAGCAAGTCGCTTTTTGCACGAGCCATGTTGTTCCAGGA
ATAGGCTTTAGTGATGATCCGCTCCTTCAAGGCCGAAATTTCTCGTATTTCGATACACAGATTAACCGATTGGGTATTAACTGGGAACAA
CTGCCAATCAATCGGCCAACCTGTCCCATC
TTCAACCATAATCGTGATGGGGCAATGAACTCTCGCATCAACGCCAATGAATTGAACTACTATCCCAACCGAGAGAATCGCGGTCACCCTATTGCCCCGAATCGCACTTCAGGCGGAGGC
TATGTGGA
CTTTCAAGAGAAGGTTCAAGGCATAAAGCAACGCGTTCGTGGAGCCAAGTTTCAGGAACACTTCAATCAGGCTCAACTTTTCTACAATTCCCTCAAGCCGCACGAGAAAGGT
CATCTTATCCGTGCATTCTCTTTCGAGTTGGATCATTGCGATGACGAACGTGTTTATAAAACATATACTGAACTTCTCAGAAACATTGACCTTGACCTCGCCAAGACAGTGGCAGAAAAC
GTTGGCGGAATCGCTCCGGATTCGCCGGCACGCCCCAACCACGGAAAAATAGCGCCGTCACTCTCCCAAGATTATTTTATGCCACCAGCTCCTACTATTGCTACTCGCAGAGTTGCAATC
CTTATTGCGGACGGGTTCAACTACATAGAGGTTCAAACAATGCGCGGCCTGCTTGCTATGGCCAAAGCCACATGTTGGATCATTGGTCCTCGCCGCGGAGAGGTCAAATCAGAAAGCCAA
ATTAGTGGAGTCGAAGGTATGACTATCAATGCGGATCATCATTATGAGGGCCAGAGGTCTACGCTCTTTGATGCTATCTTCGTTCCCTCCGGGCCTAAGCATGCCGAAGCCCTGATGCAA
AACGGCAGAGCGATACATTGGATTAGAGAAGCCTTTGGTCATTGCAAAGCTATTTCTGCCATTGGCGAAG
GGGTCGCATTTTTGAAACATGCCATTCAACTTCCTGAGGTTGACCTAGAA
TTGAATCTGGACGTTGGTAAAGTCACTACCTCCTACGGCGTTGTTACGACGGGCAAATATTCCGTAATTTCGGCCGCCGCAGAAACTTTCACATTCGGGCCCAATGATGAAGGGTTTGAA
TCGAGTTTTGCATATGAGATTAGCAAGCACAGATGCTGGGATAGAGAACTAGACGGTTTGACTGAACGAGTGGCTTTCTAG

Retrieve as FASTA