Entry information : AbVP01_bisporus
Entry ID 7593
Creation 2010-08-17 (Christophe Dunand)
Last sequence changes 2010-08-17 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-04-10 (Christophe Dunand)
Peroxidase information: AbVP01_bisporus
Name AbVP01_bisporus
Class Versatile peroxidase    [Orthogroup: VP001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Agaricaceae Agaricus
Organism Agaricus bisporus    [TaxId: 5341 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AbVP01_bisporus
start..stop
S start..stop
AbVP02_bisporus 494 5e-177 1..354 1..353
PoVP04_PC15 429 4e-151 1..352 1..354
PoVP04_PC9 424 1e-149 1..343 1..344
PoVP06_PC15 420 6e-148 1..343 1..344
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 159850..159910 61 N° 2 159963..160090 128 N° 3 160145..160203 59 N° 4 160258..160392 135
N° 5 160446..160567 122 N° 6 160625..160700 76 N° 7 160750..160786 37 N° 8 160839..160846 8
N° 9 160901..160981 81 N° 10 161031..161100 70 N° 11 161164..161173 10 N° 12 161230..161265 36
N° 13 161323..161495 173 N° 14 161561..161619 59 N° 15 161672..161684 13  
join(159850..159910,159963..160090,160145..160203,160258..160392,160446..160567, 160625..160700,160750..160786,160839..160846,160901..160981,161031..161100,16116 4..161173,161230..161265,161323..161495,161561..161619,161672..161684)


exon

Literature and cross-references AbVP01_bisporus
DNA ref. JGI genome:   scaffold_13 (159850..161684)
Cluster/Prediction ref. JGI gene:   188334
Protein sequence: AbVP01_bisporus
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   355 (334)
PWM (Da):   %s   37997.08 (35787.9)  
PI (pH):   %s   4.99 (5.09) Peptide Signal:   %s   cut: 22 range:22-355
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAFEILLSLILASNAVYFAAAVPAAKHTCPDGKNKVSHEACCALFPVLEDIQTNHFENVCGEVHEVLRIAFHDAIGWSPSGGGGGADGSIVTFSDIETKYPANEGIDDIADALKFFIDRHNLTAGDFIQFAATVGVTNCPGAPRMPFFLGRPAAIAPADDGLIPEPDSVTKMLARFKDAGFNPKEVVALLASHSIAASDTIEPLRGLPFDSTPGEFDSQFYIETMLKGTVFPGVGGNPGEVKAPIPGEIRISSDELARDDRTACDWQHFATDQKKMAREFSKAMVKISLLGQDKSKMVDCSDVIPQATPLRSKSYFPADLTVQDLEKCKKPFPRLPSNPKVSSVAPVPTQ

Retrieve as FASTA  
Remarks Complete sequence from genomic (14 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTTTGAAATTCTCTTAAGCTTGATTTTGGCTTCGAATGCTGTTTACTTTGCTGCCGGTGCGCATTAACCATTATCTATGCGGTATGTGTTGACATACCCAATGAATAGCTGTTCC
TGCCGCAAAGCACACGTGTCCCGATGGCAAGAACAAGGTTTCCCATGAGGCTTGTTGCGCTTTGTTCCCCGTTCTCGAAGATATACAAACCAACCATTTTGAAAACGTATGCGGCGAAGA
A
GTAGGTTTCTTAGTTCTTGCTGTAAAGAAGCGATCTCATGATATGATACTTAAGGTCCATGAAGTCTTGCGCATAGCATTTCACGATGCTATCGGATGGTCACCTTCGGGCGGGTACGT
TTGGTCGTCGCCCGTGGTGGTTAGCGTCACTGATGTCTTCACTTCTAGCGGTGGAGGTGCTGATGGTTCCATTGTCACCTTTTCTGATATAGAGACCAAATATCCCGCGAACGAGGGAAT
AGATGACATTGCCGACGCCTTGAAATTTTTCATAGATAGACACAACCTTACGGCTGGCGATTT
GTGCGTACACTTGGTTCGGATTTCGTGTTGCATCCTGTTAACATCTTCCTTAGCATT
CAATTTGCTGCTACTGTTGGAGTGACAAATTGTCCGGGAGCACCTCGCATGCCATTCTTCTTGGGTCGCCCAGCCGCTATAGCTCCTGCTGATGATGGTCTCATCCCAGAGCCCCCCG
GT
TAGTCCATCGACAAAACTTGAGTAGATCTCGCATCTTAAAATATCGGATCAACAGATTCGGTCACTAAAATGCTTGCTCGCTTCAAAGATGCCGGTTTCAACCCCAAAGAAGTTGTAGCA
TTGCTTGCATC
GTGAGTCCCGAGAGCAAACCGGGGGAGCATACCTTCTTATACCCCACAGTCATTCTATCGCTGCTTCGGATACGATTGAGCCTGGTGTAAGTTAAGCTTTCATTAGAAT
GCATTCATCTCATCAATCTCACCCTCCAGCTCCGAGGGTAAGAACTCTTCTGACCCACAATAAACGATCAATATTCAACACGACCCTCTAGTCTTCCCTTTGACTCAACTCCCGGCGAAT
TTGATTCCCAGTTCTACATTGAGACTATGCTCAAAGGCACTGTGTTCCCAGG
GTGAGCACTGTGCTCTCATGGCAGTTTATTGATCCTAATCTTGCTCAAGTGTTGGGGGGAACCCAGGC
GAGGTTAAAGCTCCCATACCAGGCGAAATTCGTATCTCTTCAGATGAAAGA
GTACGTGTAGGACTTCTTTGCCATCCGTGTCTACGGCTATTAACGTGATCTTCCGATGCTTAGTTAGCT
CGAG
GTCAGAATCATTGTCGAAAGCCGTTTGGTAATATTGCCCTGCTGACGTCGTTCTAGACGACCGCACCGCTTGTGATTGGCAACATTTCGCTAGTAAGCATAATCATCCATTTTGAA
GAATCTGAAACCCACTTGAGTTATCACATTTAGCCGATCAGAAGAAAATGGCTCGAGAGTTTAGCAAAGCCATGGTAAAAATATCACTACTCGGTCAAGATAAGAGCAAGATGGTTGATT
GCTCCGACGTCATTCCACAAGCGACGCCTTTGAGATCCAAGTCGTATTTCCCTGCAGATTTGACTGTTCAGGATCTCGAAAAGACT
GTAAGTTCATTTGAAACGCTCTACAAAGTTTATT
AATAAATTGAGCCTGCACGACTTTGATACAGTGCAAGAAACCTTTCCCTAGGCTCCCTTCCAACCCCAAAGTCTCTTCCGTCGCACCTGTGTAAGGTTTCTTGTCAGTTCCAAGCATCCG
CTAACGCTAAACAATTGTCTAGTCCTACACAATGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTTTGAAATTCTCTTAAGCTTGATTTTGGCTTCGAATGCTGTTTACTTTGCTGCCGCTGTTCCTGCCGCAAAGCACACGTGTCCCGATGGCAAGAACAAGGTTTCCCATGAGGCT
TGTTGCGCTTTGTTCCCCGTTCTCGAAGATATACAAACCAACCATTTTGAAAACGTATGCGGCGAAGAA
GTCCATGAAGTCTTGCGCATAGCATTTCACGATGCTATCGGATGGTCACCT
TCGGGCGG
CGGTGGAGGTGCTGATGGTTCCATTGTCACCTTTTCTGATATAGAGACCAAATATCCCGCGAACGAGGGAATAGATGACATTGCCGACGCCTTGAAATTTTTCATAGATAGA
CACAACCTTACGGCTGGCGATTT
CATTCAATTTGCTGCTACTGTTGGAGTGACAAATTGTCCGGGAGCACCTCGCATGCCATTCTTCTTGGGTCGCCCAGCCGCTATAGCTCCTGCTGAT
GATGGTCTCATCCCAGAGCCCCCCG
ATTCGGTCACTAAAATGCTTGCTCGCTTCAAAGATGCCGGTTTCAACCCCAAAGAAGTTGTAGCATTGCTTGCATCTCATTCTATCGCTGCTTCG
GATACGATTGAGCCTGGT
CTCCGAGGTCTTCCCTTTGACTCAACTCCCGGCGAATTTGATTCCCAGTTCTACATTGAGACTATGCTCAAAGGCACTGTGTTCCCAGGTGTTGGGGGGAAC
CCAGGCGAGGTTAAAGCTCCCATACCAGGCGAAATTCGTATCTCTTCAGATGAAAGA
TTAGCTCGAGACGACCGCACCGCTTGTGATTGGCAACATTTCGCTACCGATCAGAAGAAAATG
GCTCGAGAGTTTAGCAAAGCCATGGTAAAAATATCACTACTCGGTCAAGATAAGAGCAAGATGGTTGATTGCTCCGACGTCATTCCACAAGCGACGCCTTTGAGATCCAAGTCGTATTTC
CCTGCAGATTTGACTGTTCAGGATCTCGAAAAGACT
TGCAAGAAACCTTTCCCTAGGCTCCCTTCCAACCCCAAAGTCTCTTCCGTCGCACCTGTTCCTACACAATGA

Retrieve as FASTA