Entry information : AbHalPrx03_bisporus
Entry ID 7595
Creation 2010-08-17 (Christophe Dunand)
Last sequence changes 2010-08-17 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-04-10 (Christophe Dunand)
Peroxidase information: AbHalPrx03_bisporus
Name AbHalPrx03_bisporus
Class Haloperoxidase (haem)    [Orthogroup: HalPrx001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Agaricaceae Agaricus
Organism Agaricus bisporus    [TaxId: 5341 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AbHalPrx03_bisporus
start..stop
S start..stop
AbHalPrx04_bisporus 699 0 1..374 1..375
LbiHalPrx05 499 5e-178 5..371 14..385
AbHalPrx05_bisporus 467 9e-166 1..371 1..370
AdelHalPrx01 365 1e-125 2..370 3..382
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 261078..261353 276 N° 2 260970..261027 58 N° 3 260726..260917 192 N° 4 260614..260666 53
N° 5 260019..260564 546  
complement(join(260019..260564,260614..260666,260726..260917,260970..261027,2610 78..261353))


exon

Literature and cross-references AbHalPrx03_bisporus
DNA ref. JGI genome:   scaffold_15 (261353..260019)
Protein sequence: AbHalPrx03_bisporus
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   374 (354)
PWM (Da):   %s   40823.3 (38700.2)  
PI (pH):   %s   6.91 (6.91) Peptide Signal:   %s   cut: 21 range:21-374
Sequence 415
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MFSLINFVALALACTWSALAFPPSYASLGGLPREELDRILPSLQYRSPGAPPGPLKFNGTKLVNDHQHPWKPLKHGDIRGPCPGLNTLASHGYLPRNGIATPAQIINAVQEGFNMENSVARLVVYAAHLVDGNLITDKLSIGGKSPLTGPSPQAPANAAGLNTHALFEGDASMTRADAFFGDNHSFNETLFDEFTAFSNRFGAGKYNLTVAAEYRFHRIQESIATNPNFSFVSPRFFTAYAESVFPINFFIDGRQGDGQLDLDVARGFFQNMHMPDGFHRARKPMGIEGLEIANVHPISPGANVNGVNTYTPDPSSADFTTFCLLYVNFVNQTVRSLYPNPTGNLKKALTKNLEFLYYPFSDQCSQVFPYGNDN

Retrieve as FASTA  
Remarks Complete sequence from genomic (4 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTTCAGCCTTATCAATTTCGTCGCTCTCGCACTTGCTTGCACTTGGTCTGCTCTAGCTTTTCCTCCATCATATGCTTCATTGGGAGGTTTGCCGAGAGAAGAATTGGACAGAATATTG
CCATCTCTCCAGTATCGCTCCCCGGGAGCTCCTCCTGGCCCTCTGAAATTCAATGGCACTAAGCTCGTCAATGACCACCAACACCCATGGAAACCTTTGAAACATGGTGACATTCGAGGG
CCATGTCCAGGATTGAATACGCTTGCTTCGCATGGA
GTTCGTTTCAATGATCTGTTGAATATATTTAGCCTAACCACTGTTCTTAGTATCTCCCCCGTAATGGTATTGCGACGCCTGCTC
AAATCATCAACGCCGTCCAGGAAG
GTGTGTAATGCGTGATTCATGTATATATCTTATAAATCAACATTCTCGCTAGGTTTCAACATGGAGAACAGTGTCGCGAGACTAGTAGTCTATGCT
GCCCATCTAGTTGATGGTAATCTCATCACAGACAAACTCAGCATCGGCGGGAAGAGTCCGTTGACTGGTCCTAGCCCACAGGCCCCAGCTAATGCGGCAGGTTTGAATACGCATGCTCTG
TTCGAGGGAGATGCAAGCATGACTCGAG
GTCCGTTGCGCGAACTATGCCACGTGTTAGGCAGCATTCTCACTGTCTTCCATATTCAGCGGATGCCTTTTTTGGTGACAACCACAGCTTCA
ACGAGACACTATTTGACGAG
GCCGGTCTTCTCTAATTTTGTATATTCAGCATGGCTGATGACTTCACAGTTTACTGCCTTCAGCAACCGATTCGGTGCCGGAAAATACAACCTTACGGTT
GCTGCGGAGTACCGATTTCATCGGATTCAAGAATCGATCGCGACGAATCCCAACTTTTCCTTCGTGTCGCCTCGATTTTTCACTGCTTATGCAGAGTCTGTGTTCCCCATCAATTTCTTC
ATAGATGGGCGCCAGGGAGATGGCCAATTGGACCTTGACGTTGCTCGTGGCTTCTTCCAGAACATGCACATGCCAGATGGGTTCCATAGGGCCCGTAAACCGATGGGGATTGAGGGCCTC
GAAATCGCTAACGTTCACCCCATTTCTCCTGGTGCCAATGTCAACGGGGTTAATACTTATACTCCTGATCCCAGCTCCGCTGACTTCACAACCTTCTGTCTGTTGTATGTGAATTTTGTA
AATCAAACCGTGCGCAGTCTTTACCCGAACCCAACTGGTAATTTGAAGAAGGCGCTCACCAAGAATTTGGAATTCTTATATTACCCATTCAGCGATCAATGTTCTCAAGTTTTTCCTTAT
GGAAATGACAATTG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTTCAGCCTTATCAATTTCGTCGCTCTCGCACTTGCTTGCACTTGGTCTGCTCTAGCTTTTCCTCCATCATATGCTTCATTGGGAGGTTTGCCGAGAGAAGAATTGGACAGAATATTG
CCATCTCTCCAGTATCGCTCCCCGGGAGCTCCTCCTGGCCCTCTGAAATTCAATGGCACTAAGCTCGTCAATGACCACCAACACCCATGGAAACCTTTGAAACATGGTGACATTCGAGGG
CCATGTCCAGGATTGAATACGCTTGCTTCGCATGGA
TATCTCCCCCGTAATGGTATTGCGACGCCTGCTCAAATCATCAACGCCGTCCAGGAAGGTTTCAACATGGAGAACAGTGTCGCG
AGACTAGTAGTCTATGCTGCCCATCTAGTTGATGGTAATCTCATCACAGACAAACTCAGCATCGGCGGGAAGAGTCCGTTGACTGGTCCTAGCCCACAGGCCCCAGCTAATGCGGCAGGT
TTGAATACGCATGCTCTGTTCGAGGGAGATGCAAGCATGACTCGAG
CGGATGCCTTTTTTGGTGACAACCACAGCTTCAACGAGACACTATTTGACGAGTTTACTGCCTTCAGCAACCGA
TTCGGTGCCGGAAAATACAACCTTACGGTTGCTGCGGAGTACCGATTTCATCGGATTCAAGAATCGATCGCGACGAATCCCAACTTTTCCTTCGTGTCGCCTCGATTTTTCACTGCTTAT
GCAGAGTCTGTGTTCCCCATCAATTTCTTCATAGATGGGCGCCAGGGAGATGGCCAATTGGACCTTGACGTTGCTCGTGGCTTCTTCCAGAACATGCACATGCCAGATGGGTTCCATAGG
GCCCGTAAACCGATGGGGATTGAGGGCCTCGAAATCGCTAACGTTCACCCCATTTCTCCTGGTGCCAATGTCAACGGGGTTAATACTTATACTCCTGATCCCAGCTCCGCTGACTTCACA
ACCTTCTGTCTGTTGTATGTGAATTTTGTAAATCAAACCGTGCGCAGTCTTTACCCGAACCCAACTGGTAATTTGAAGAAGGCGCTCACCAAGAATTTGGAATTCTTATATTACCCATTC
AGCGATCAATGTTCTCAAGTTTTTCCTTATGGAAATGACAATTG

Retrieve as FASTA