Entry information : AbHalPrx04_bisporus
Entry ID 7596
Creation 2010-08-17 (Christophe Dunand)
Last sequence changes 2010-08-17 (Christophe Dunand)
Sequence status complete
Reviewer Nizar Fawal
Last annotation changes 2012-04-10 (Christophe Dunand)
Peroxidase information: AbHalPrx04_bisporus
Name AbHalPrx04_bisporus
Class Haloperoxidase (haem)    [Orthogroup: HalPrx002]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Agaricaceae Agaricus
Organism Agaricus bisporus    [TaxId: 5341 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AbHalPrx04_bisporus
start..stop
S start..stop
AbHalPrx03_bisporus 717 0 1..375 1..374
LbiHalPrx05 509 0 5..373 14..386
AbHalPrx05_bisporus 466 3e-165 1..373 1..371
AdelHalPrx01 361 5e-124 2..371 3..382
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 3085620..3085895 276 N° 2 3085951..3086008 58 N° 3 3086067..3086258 192 N° 4 3086318..3086370 53
N° 5 3086420..3086968 549  
join(3085620..3085895,3085951..3086008,3086067..3086258,3086318..3086370,3086420 ..3086968)


exon

Literature and cross-references AbHalPrx04_bisporus
DNA ref. JGI genome:   scaffold_2 (3085620..3086968)
Protein sequence: AbHalPrx04_bisporus
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   375 (355)
PWM (Da):   %s   40803.27 (38650.2)  
PI (pH):   %s   6.42 (6.42) Peptide Signal:   %s   cut: 21 range:21-375
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MFSLLNFVTLALACTWSALAFPSSYTSLGGLPREELDRILPSLQYRSPGAPPGPLKFNGTKLVNDDQHPWKPLKHGDMRGPCPGLNTLASHGYLPRNGIATPVQIINAVQEGFNMENSVARLVTYAAHLVDGNLVTDKLSIGGKSPLTGPSPPAPANAAGLNTHALFEGDVSMTRADAFFGDNHSFNETLFDEFTAFSNQFGAGKYNLTVAAEYRFHRIQESIATNPNFSFVSPRFFTAYAESVFPINFFIDGRQGDGQLDLDVARGFFQNMRMPDGFHRASIPTGLEGLAEIASVHPISPGANVNGVNTYTFDPSSADFTTFCLLYVNFVNQTVRSLYPEPTGNLKKALKKNLEFLYGPFSDQCSQVFPYGKDN

Retrieve as FASTA  
Remarks Complete sequence from genomic (4 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTTTAGCCTTCTCAATTTCGTCACTCTCGCGCTTGCTTGCACTTGGTCTGCTCTTGCTTTTCCTTCATCATATACTTCATTGGGCGGTTTGCCCAGAGAAGAATTGGACAGAATATTG
CCATCCCTCCAGTATCGCTCCCCGGGAGCTCCTCCTGGTCCTCTGAAATTCAATGGCACTAAGCTCGTCAACGACGACCAACACCCGTGGAAACCTTTGAAACATGGTGACATGCGAGGG
CCATGCCCAGGATTGAATACGCTTGCTTCGCATGGA
GTTAGTTTGAATGTTTGAAGCCGTTGAATATATTTAGTCTAACCATCGTTCTCAGTATCTCCCTCGTAATGGTATTGCGACGCC
TGTTCAAATCATCAACGCCGTTCAGGAAG
GTGTGTAATATATAATTCAAATATATATCTTATCCCCATAAATTAACATCCTCACTAGGTTTTAACATGGAGAACAGTGTCGCGAGATTAG
TAACCTATGCTGCCCATCTGGTTGATGGTAATCTTGTCACAGACAAACTCAGCATCGGCGGAAAGAGTCCGTTGACTGGTCCTAGCCCACCGGCCCCAGCTAATGCGGCAGGTTTGAATA
CGCATGCTCTGTTCGAGGGAGATGTAAGCATGACTCGAG
GTCCGTTGCGCGAACTATGCCACATGTTAAATAGCATTCTAATCGTCATCCATGCTCAGCGGATGCCTTCTTTGGTGACAA
CCACAGCTTCAACGAGACACTATTTGACGAG
GCGGGTCTTTTCTAATTTCGTAGTTTCACCATCACTGACGACTTTACAGTTTACTGCCTTCAGCAACCAATTCGGTGCCGGAAAATACA
ACCTTACGGTCGCTGCGGAGTACCGATTTCATCGGATTCAAGAATCTATCGCGACAAATCCCAACTTTTCCTTTGTGTCCCCTCGGTTTTTCACTGCTTATGCCGAGTCCGTGTTCCCCA
TCAATTTTTTCATAGATGGGCGTCAGGGAGATGGCCAATTGGATCTTGACGTTGCTCGTGGCTTCTTCCAGAACATGCGGATGCCAGATGGATTCCATCGGGCCAGTATACCGACGGGGC
TTGAGGGCCTCGCCGAAATCGCTAGCGTTCACCCCATTTCCCCCGGTGCCAATGTCAACGGGGTCAATACTTATACTTTTGATCCCAGCTCCGCTGACTTCACAACCTTCTGTCTGTTGT
ACGTGAATTTTGTAAACCAGACCGTGCGCAGTCTCTACCCAGAACCAACTGGTAATTTAAAGAAGGCGCTCAAAAAGAATTTGGAATTCTTATATGGCCCATTCAGCGATCAATGTTCCC
AAGTTTTTCCTTATGGAAAGGACAATTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTTTAGCCTTCTCAATTTCGTCACTCTCGCGCTTGCTTGCACTTGGTCTGCTCTTGCTTTTCCTTCATCATATACTTCATTGGGCGGTTTGCCCAGAGAAGAATTGGACAGAATATTG
CCATCCCTCCAGTATCGCTCCCCGGGAGCTCCTCCTGGTCCTCTGAAATTCAATGGCACTAAGCTCGTCAACGACGACCAACACCCGTGGAAACCTTTGAAACATGGTGACATGCGAGGG
CCATGCCCAGGATTGAATACGCTTGCTTCGCATGGA
TATCTCCCTCGTAATGGTATTGCGACGCCTGTTCAAATCATCAACGCCGTTCAGGAAGGTTTTAACATGGAGAACAGTGTCGCG
AGATTAGTAACCTATGCTGCCCATCTGGTTGATGGTAATCTTGTCACAGACAAACTCAGCATCGGCGGAAAGAGTCCGTTGACTGGTCCTAGCCCACCGGCCCCAGCTAATGCGGCAGGT
TTGAATACGCATGCTCTGTTCGAGGGAGATGTAAGCATGACTCGAG
CGGATGCCTTCTTTGGTGACAACCACAGCTTCAACGAGACACTATTTGACGAGTTTACTGCCTTCAGCAACCAA
TTCGGTGCCGGAAAATACAACCTTACGGTCGCTGCGGAGTACCGATTTCATCGGATTCAAGAATCTATCGCGACAAATCCCAACTTTTCCTTTGTGTCCCCTCGGTTTTTCACTGCTTAT
GCCGAGTCCGTGTTCCCCATCAATTTTTTCATAGATGGGCGTCAGGGAGATGGCCAATTGGATCTTGACGTTGCTCGTGGCTTCTTCCAGAACATGCGGATGCCAGATGGATTCCATCGG
GCCAGTATACCGACGGGGCTTGAGGGCCTCGCCGAAATCGCTAGCGTTCACCCCATTTCCCCCGGTGCCAATGTCAACGGGGTCAATACTTATACTTTTGATCCCAGCTCCGCTGACTTC
ACAACCTTCTGTCTGTTGTACGTGAATTTTGTAAACCAGACCGTGCGCAGTCTCTACCCAGAACCAACTGGTAATTTAAAGAAGGCGCTCAAAAAGAATTTGGAATTCTTATATGGCCCA
TTCAGCGATCAATGTTCCCAAGTTTTTCCTTATGGAAAGGACAATTGA

Retrieve as FASTA