Entry information : AImeMPO
Entry ID 7696
Creation 2010-11-12 (Marcel Zamocky)
Last sequence changes 2011-01-27 (Catherine Mathe)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2011-02-02 (Christophe Dunand)
Peroxidase information: AImeMPO
Name AImeMPO
Class Myeloperoxidase    [Orthogroup: MPO001]
Taxonomy Eukaryota Metazoa Chordata Mammalia Ursidae Ailuropoda
Organism Ailuropoda melanoleuca (Giant panda)    [TaxId: 9646 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AImeMPO
start..stop
S start..stop
CfaMPO 1310 0 16..719 32..734
OgaMPO 1298 0 18..718 18..718
FcaMPO 1284 0 16..719 17..720
MmMPO 1262 0 18..718 18..718
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 218200..218275 76 N° 2 218396..218489 94 N° 3 218805..218980 176 N° 4 219199..219322 124
N° 5 219409..219538 130 N° 6 219635..219841 207 N° 7 220619..220937 319 N° 8 223072..223232 161
N° 9 224339..224594 256 N° 10 225056..225226 171 N° 11 225817..226054 238 N° 12 226811..227018 208
join(218200..218275,218396..218489,218805..218980,219199..219322,219409..219538, 219635..219841,220619..220937,223072..223232,224339..224594,225056..225226,22581 7..226054,226811..227018)


exon

Literature and cross-references AImeMPO
Literature Li R., et al. (2010) The sequence and de novo assembly of the giant panda genome. Nature 463:311-317.
Protein ref. UniProtKB:   D2I2J9 [Incorrect prediction]
DNA ref. GenBank:   GL194178.1 (218200..227018)
Protein sequence: AImeMPO
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   271 (697)
PWM (Da):   %s   29362.62 (78734.1)  
PI (pH):   %s   6.68 (8.69) Peptide Signal:   %s   cut: 23 range:23-719
Sequence 761
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MQLLPALAGLLAVLAVPQCSQGAGPAVPEEVETAVVLTCMKEAKRLVDMAYKERRESIKRRLHSGLASPMELLSYFKQPVAATRTAVRAADYLHVALSLLEGKLRPLWPRPFNVTDLLTPAQLNLLSTSSGCAYQDVRVTCPENDKYRTITGHCNNRRSPTLGASTRAFARWLPAEYEDGFSLPFGWTPGVKRGGFPVPLARAVSNAIVRFPTDQLTPDQERSLLFMQWGQLIDHDLDLSPEPAARVSFVTSVNCETSCLQQPPCFPLQIPPDDPRIKNQRDCIPFFRSSPACTDSNFTIRNQINALTSFVDASMVYGSEDPLAAKLRNTTNELGLMAVNTRFNDNGRALLPFDDLHDDPCLLTNRTANIPCFLAGDTRSSEMPELTSMHTLFLREHNRLATELKRLNPGWDGERLYQEARKIVGAMVQIITYRDYLPLVLGPRAMRKYLPRYRSYNDSVDPRIANVFTNAFRYGHTLIQPFMFRLDDRYQPMGPNPRVPLSKVFFASWRVVLEGGIDPILRGLMATPAKLNRQNQIVVDEIRERLFEQVMRIGLDLPALNMQRSRDHGLPGYNAWRRFCGLPQPSTLGELTTVLKNCNLADKLMRQYGTPDNIDIWMGGVAEPLEPYGRVGPLLACLIGTQFRKLRDGDRFWWENPGVFSRQQQQALARISLPRIICDNTGITTVSKNNIFMSNTFPRDFVSCNTLPTLDLTPWRDSN*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo unknown). No EST found.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGCAGCTGCTGCCGGCCCTCGCAGGGCTCCTGGCCGTCCTGGCCGTGCCCCAGTGCTCTCAGGGTGCTGGTCCAGGTAATGATGCAGAAGGGAAGAGGTGGTATGTTGGGGGGTGGTTCT
GCGTCCCAAGGGCTCGGTGCAGGCCACCCTGGCTCTGGGGCCCATTCCTGATCTTGTGACCCATGTTCTGGGCAGCTGTCCCGGAGGAGGTGGAGACCGCAGTGGTACTGACCTGCATGA
AGGAAGCCAAGCGACTAGTGGACATGGCCTACAAGGAGCGGCGGGAGAG
GTGGGGTACCTGGCACTTCCCTGCCCCAGGTCTTTCAGAGAAGGAACTTGACATGGGGACTTCATGGGTGG
GGATGGAGCCCCTGTCTGTCTGTCAGTCTTTATGTCTTTAGATTTCAGAACATCTTCAAAACCATCTCTCCCCATGGCCTGGCCTCTGTCTGGACACCCGGGTCCATACTCTGTTTATAA
AGAGAGACCTTCTTCCCGTCTGTGGGTCTGTCTGCACTGTCCTGTGTGCTGGCTTGGGGCTAGGGCTCTGCTGAGTGTCTCCATCCCCGCTGTCTCTGGCCTCACTCCTCCCTTCTCCAA
GCAGCATTAAGCGGCGGCTTCACAGTGGCTTGGCCAGCCCCATGGAACTCCTGTCCTACTTCAAGCAGCCGGTGGCAGCCACCAGGACAGCTGTGAGGGCTGCTGACTACCTGCACGTGG
CCCTAAGCCTGCTGGAGGGGAAGCTGCGGCCTCTGTGGCCGAGGCCCTTCAACGTCACTG
GTACTGTCGCCCCTACAACCCCAGTCTTCTGCTCCACTAGTGACCTCGGTCATCTCCCAG
TGACCCCCGCCCCCCACTGCTCTTCTGGCGAGTCTCGGGAGCCCCGGAGTCTGCTCTCGGTGTCCTCAGACTGGGCCCCTAACCAAGGCTGCCCAGCTTAGGCTAGGAAATGGGGAGGGG
GGGACTCAGCAACCACGCCCGGCTTTCCCCGGCCCCAGACCTGCTGACACCGGCCCAGCTGAATCTGCTGTCCACGTCGAGCGGCTGCGCCTACCAGGACGTGAGGGTGACGTGCCCGGA
GAACGACAAGTACCGCACCATCACCGGCCATTGCAACAACAG
GTGCGGCCGGCTGCGGGCGACCCCTCGGCGGGCGGGCGGCTCCTTGCGGGGCCAACTCGCGTCAGCGCCACGTCCTCC
CGCTGCAGGCGCAGCCCCACGTTGGGGGCCTCCACCCGCGCCTTTGCGCGCTGGCTGCCCGCCGAGTACGAGGACGGCTTCTCGCTGCCCTTCGGCTGGACGCCCGGGGTCAAGCGCGGC
GGTTTCCCGGTGCCCCTG
GTGAGCACCGGCCGGCGGGAGGTGGGGGGCTGAGGGGGAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCCCCTGACGCTCCGTGTCCCGCAGGCGCGC
GCCGTCTCCAACGCCATCGTGCGCTTCCCCACGGACCAGCTGACCCCGGACCAGGAGCGCTCTCTCCTGTTCATGCAGTGGGGCCAGCTGATCGACCACGACCTCGACCTGAGTCCGGAG
CCGGCCGCCCGGGTCTCCTTCGTCACTAGTGTCAACTGCGAGACTAGCTGCCTGCAGCAGCCGCCCTGCTTCCCGCTTCAG
GTGCTCCCTTCCTCCTGCCCCGCCGCTGCCTGCCGGGTG
GGGAGAAGGGGAAGCCTTCCTGGAAGAGGCCAGCTCTCGCTGTGTTCAGAGTTCCCTCCCCCGCAACTGAGTAAGGCTGGCCCTGCCTACCCACTTGCCTCCGCCTCCCTCCAAACCCCG
CGTGTCGGTGCCGGGGTGCTTAGTCCTTTCCTCCGCACAGAGCGCCACCTGCCCTCCCCACCCCCGCCTCTGGCGCACATAGCACAGAACCTAGGCTGTCGGTTGCAGCAGGGCTGGAGG
GGACTGTTTGGTTGGGGCACACACCCAGTAGGGAGAGGAGGAGAGAAAGGAAGGAGAATGGCAGAGAGCCAGAGAGAGGAAAGAAAGGCAGGGGTCAGAGTGAAAGACAGGAAAGGGATA
GGAAAGGGGGGATCAGGAAAGGAAAAGCAAGAGGAGGCTAACTGAGAGTTAGAGACCACATCCAGAGAACACCGGGGGAGGGAAGGGCAGACACCCTGGAGAAAAGGAAAGAAAGGAAGT
TTATGTGAGGACTGGCTGGCCCTCCTCCAGGGGGTCGCACATGCCCCCTTCCACAGTTCTGGTCACCACCCCCAAAGCTCGAAGCTCCAGGGCACTCTGCCGGTGCAACCTCAGGCCAGA
AGCCCTCAAGAGCCCTCGTTTCGGTGTCTGGGTCTCCCCCTCGGGTCCTGGGTTCCAGGCTGCTTTGGAGGTGGGATCAAGGCCTTGGGGTGGGGGGGGGTGGACAGGAGGAGAGCCAAC
CGGCCCTATGTGTCACAGATCCCGCCCGATGACCCCCGCATCAAGAACCAGCGTGACTGCATCCCCTTCTTCCGCTCCTCGCCAGCCTGCACAGACAGCAACTTCACCATCCGCAATCAG
ATCAACGCACTCACCTCCTTCGTGGATGCCAGCATGGTGTACGGCAGCGAGGACCCTCTGGCCGCCAAGCTTCGAAACACGACAAATGAGCTGGGGCTGATGGCCGTCAACACCCGCTTC
AACGACAACGGTCGGGCCCTGCTGCCCTTCGACGACCTGCACGATGACCCCTGCCTCCTCACCAACCGCACAGCGAACATCCCCTGCTTCCTGGCAG
GTCAGCCCCGAGTGGGAATCTGG
GGTGGTGCCGGCGGGGGGTTGGCACTCGGCGCTGGGGCCACAGGGGACCTGTTGGTGAACAGCCCGTGGGTTTGCGTTTAGAGAGACTCTGTCCTCACCAACTTCACATTAATCCAGTTG
CCTCGGTGACAAGCTGGATGGAGCCAGAAAGGCAAACAAACCCAAAACGAAAACCCAAACCCAAAACCACACAAATAACCCCAAACCCAAACTAACCAAAACCAAAAAGCCAAACCTAGG
AAGGAGACTCGGGGGTGGCTGCGGAACCACTGTCCCTCTGCCCATCCCTTTCGCCATCTCTCCTTCTCCCTCTGGACTCGGGCAGAGAGTTGAGTCCCCAGGGACAGGGAACTAAGGGGA
CAGAGAGCAACGTGGCACCCTCACTCTCTAGACCTGCGTCATCCGCTGTGCTAGCCACCAGCCACATGCGGCAATTTCCATTTAAATTTAATTCAGATTAATTGAAATTAAATGGAAAAT
TCAGTTCCTCTGCTGCACTAGCCACATTTCAAGTGTTCAGTAACCTCACAGGCTAGTGGTTCCCATATAGGGCAGCACAGATGTCCAACATTTTCATCAATTTGGAAAGTTCTATGGGAC
GGCACTGCTCCGGAATTACCCCCCCCCCACCATCTTGATTCCCTGTCGAAGAGAGGGTGCGATTTTAGATTGAAACACCTGGCAGCCCTGGGGATATGGTTGGGGCAGTAATGGTGCCCA
TGCCCAGAAATTTCCAATGTTTCCTTTTTCTTTTTTTAAAAAAGATTTTAATTTTTTAAAAAGATGTATTTATTTATTTGAGAGAGAGAGAGAGCAGGGGGAGGGGGAGAGGGAGAGGGA
GAAGCACTCAGCTGAGCGTGGAGCCTGAGGTCATGACCTGAGCCGAAATCAAGAGTTGGACACTCAACTGACGGACATACCCAGGTGCCCCAAGATTTTATTTTTAAGTAATCTCTACAC
CCAACCTGGGGCTCAAACTTACAACCCCCAAATCAAGATTCATATGTCCCACCCACTGAGAGGTCAGGCAACCCTCCAATATTTTTTTAATGTAAATCCAAGAGTGGTCCTGAGGCCCCT
GCATTCACATCTGGCCTCCCAGCCTCTCCTCCCGTTGACTTCTGGTGGTCTCTCCCCTGCCTGAGCCTTGGGGACGAGAACCGAGGTCAGCTGCGGTCCACACTGGAGCCGACACTTTTC
TGGGCTGGTGAGGGAAGAGCAGCGCTCCTCAGCCAGTTACGGCCGCCCCCGTCCTGGCATCGTGTCCTGGGCCTGGATCATTGTGACCTCATGGGATAGTAAACCTGCTCTCAGAGACTC
TTTCCCACCAGCATCTGGAGCTGATAAAGACTGGACCCAGTGTCCTGGTAAAAGGGCCTGGCCCTAACTCCTGGGCCCTTCCAGAGAAGAGGTGGGGAGGACGAGAGGATTAGAGATCTC
ACTTGGTTTTTGTTTTTGTTTTTTGTTTTTTTTGACTCTCGGAGCTTGAGCAGGCTGCAAATTAGCATGTAGTAAGGCTGGGGATGGCAACTCTGATTAGATGGTGTGGCTTTCTAGAGT
CCTGTGTTGAGAGGGATTCTGGGGCTGAGTCCAGTCTGAGCAGGAGAGAGCGCTGTGGTCATGAGCTGTCTGACGGCATGGAAGTAGGGAGCGCCGACACGCATGCTACTTTTTGGCCTT
CCCTGCATCAAGAGACTAAGTCAACCAGGCAGTTCATGAATCACCTACTTTGTAGCGGGCATGGTGTGAAACTCCGGATGTCTGTGTGTGAGCTGGGTGGAGTGTCAGATGCAAAAAGGC
ACGAGCCCTGGTCCTCATCCTCAAGGAGCGCCCAGTCTCAGCTACTAGAATGTGGCAAGTCACGTGTCAGCTCTGATGCCTATTGAATGAGCATCTCCAACCAGCAGTGCCTCTTCGCAG
AGGAAGAAGTTATCACGGTGGGCCAGGGCAGCAAGGGAGGACCTCCTAGAGGAGGCGCACACTGAGTGCGGTGTGGAAAGATGGATAGAGAGGAAGTCTGGGTTTCAGACCTTGGTTGAG
GAGGGAGTTTCGGTGGAGCAAGTCCTTTCTGATGGGATCTTAGGAATGACAGTGGCTTTTGCTTCCCCAAGGGGACACCCGCTCAAGTGAGATGCCTGAGCTCACCTCCATGCACACACT
CTTTCTGCGGGAGCACAACCGGCTGGCCACGGAGCTCAAGCGCCTGAACCCTGGCTGGGATGGAGAGAGGCTCTACCAGGAAGCCCGCAAGATCGTGGGAGCCATGGTCCAG
GTAGGCAG
TCCTGAGCATTGGTGATGCCAGGGGTCAGGCAGGCTTGGGATCCAAACACGGCCCTACCACATCCTCGCTGTGTGACCTGGGGCACGTTAACCCCCATGAGCCTCAGTGTGTGCGTCCAT
GATGCTGTAAAGTTTAAATGATCTATGTGAAAACACCTGGCAGATACTAAGGGCCTGATAAAGGTTACTTGGCTTCCATCCCCTCCTTCCTAGGCTGGCTCCCCTCTCTGCTCTCCTGTC
CATTAGAAATGGCTTCAGGAGGGTTAAAGGGGTGGGTCTGAAGTGCCAGCACATGGTAGCTGGTCAGTAAATGCCTTTCCTTTCCTTTCTTCATCTCCTCACGGCTCTTGGCTCCTTTAC
CCACTCATCTCTTCTTTTGGCTCTATCATAGCTCACCCAATCTCCTCACCCTTGTTTATCCCTGGGGAGCGTTCCTGGTTCTCTCTCCCAGCTTCTGATGCTTCAGCACCCCCATCCTCT
CCACAAGACACACACACACCTTTTTCATACTCTTTAGACTCTGGAGGGGGAGAGAGTTGCAGGTGTGGAGGCTAAGTTTTTGCTTTGCACCAAGAACTTCAGTGAGATTCATTGAAGCCT
TGCAGAAAATTCCAGACTCTAGAATCTATACTTTCTCTTTGCCCTGGGGGAAATCATCTAGGGTGGCCCTTTTCCTTTTTGCCTCCCCTCTTCCACAAATGCATATTGAGCCCAACCGTG
AGCCAGGTGCTTGCTGGGCACCGAGTAATTTCAAGAGAAATAAGATGCAACCCTTGCTCTCAGGAGCTTATAAGTTAGGAGAATAAAAGACATGAATAACTCAAGGGCAAAGGAGCTATT
GACCAACGAAGCCCTTTGTTATTTAATCCTTTAAGGCAGAGGGCAACATAATTATCCTAAATTTACGTTTGAGTAACTGGGGCTCCCCGAGGGTTATACCTGGCCCAAAGTCACACAGCA
GGCAAGCAGTGGAGCTGTGTTTGCTACTCGGTGCCACCCTGTTAGCCCCAGATCCCGCGCTGTGGGAGACAACTCCCTGGCTGTGGACAGTGGAGGAGGGTGAGTGGAGAGGCCCCTCTA
AGCACGACGTTTCTTTAGATCATCACTTACCGGGACTACCTGCCCCTGGTGCTGGGACCGCGGGCCATGAGGAAATACCTGCCGAGGTACCGGTCCTACAACGACTCCGTGGACCCTCGC
ATCGCCAACGTCTTCACCAATGCCTTCCGCTATGGCCACACCCTCATCCAGCCTTTCATGTTCCGCCTGGATGACCGGTACCAGCCCATGGGGCCCAACCCCCGCGTTCCACTCAGCAAG
GTCTTCTTCGCTTCCTGGAGAGTAGTGCTGGAAG
GTGAGCGGGACCTCGGCCAGGAGCCATCGGGCTGGCCACTGAGGACATGGGGGGGGGTGGCCTTGGCTGCAGGGAGCCAGGGCAGG
AGAAATCCTCAGCCTTCCCTCTTTGGGGATCCTATCTGGCTGTCCAGCCTCAGTTCACCTGACTGCTTCTGTATATAATAATAAAGGGTGGGGTGCAGATGGCTCGCGGGGAGCTGGCTC
CTTCCTGTGTGTTACGATTCTCAGTGACCCAGGGGCTGGGTGCACCCCAGCTTGCAAGTCTGAATGGCATTATCCCCTGAGACCTCAATTCCCCAGCAAAGATCTGCCCCCTGAGGCCGT
CTTGGCATCAGGAGCTGCATGGGCCCAGCCCTCTTCTGCAATCCCCTGACTGTACCTGGGACTTTTCCCTAACTCCAGTCTCAGCTCTGGGTACTGAGCCGGATCCTTCCCCAAGTCTCA
CTCCTCTTGTCCCAGGTGGCATCGACCCCATCCTGAGGGGCCTCATGGCCACCCCTGCCAAGCTGAATCGCCAGAACCAAATCGTGGTGGACGAGATCCGGGAGCGGTTGTTTGAGCAGG
TCATGAGGATCGGGCTGGACCTGCCCGCTCTGAACATGCAGCGCAGCCGGGACCACGGCCTCCCAG
GTGAGGGGCTGCAGGAGCCCCCCTGCGCCCTCCCCACCTCCCACTCTAGGGCCC
TGCCCCCTGCAGCGGACCCCAGCTGCCCAAGTGGGCTGGAAACCTGGCTCATCACATTTCATGTGGCTGAACTTTGAGGGGGAACAGATTATTGTCACTTCCATTTTACTGATGAGCAAA
CTGAGGCTTGAAGAGATTTGGAACCTGTGCCGGTTCTCCAGCCGTCAGTGATCGAGCTTGAAACTGAACCGAGATCAGCTTAACCCCAAAGCCTGTGCCTCCATTATGGGACAGTTGGTG
TGGCTGAACCTTCTAGCCACACTTCACCCCTCCCGGGTCTGAGATCTTCCGAGGGGACACCGAGAGGTTTCTGTTCTTGGAGTTGTAGCATTTACGGCGGTTGAGGATTTGTCTCGCAGT
GGAGGGCAAAGGAAAGAGAGAGGGTCTTGGCCCTTCAGTTCAGGGCTCCCTGGGGGCTTACAGCCTGGGAGAAGCCCCTCTGCGTCCTCCTCTCCCTCATGTCCCTCGGTATATGGCGTG
CAGGGGAGGTGGGCTTTGTGGGACCCTCCCACAGCAGTGCTGCGCCCACCCCGCAGGGTACAATGCCTGGAGGCGCTTCTGCGGGCTCCCCCAGCCCAGCACCTTGGGCGAGCTGACAAC
GGTGCTGAAGAACTGCAACCTGGCGGACAAGCTGATGCGGCAGTACGGCACGCCGGACAACATTGACATCTGGATGGGCGGCGTGGCCGAGCCCCTGGAGCCCTACGGCCGCGTGGGCCC
GCTCCTTGCCTGCCTCATCGGGACCCAGTTCAGGAAGCTCCGCGATGGTGACCG
GTGAGGCGCGGCCAGTGGCTGCTGGCCGCCGCTGTGTGGTTGCAGGCCTACTCCCCAACCTCTGGA
GGGGGGCCCCCACTCCGCCTGTGAAGTGAGGGGCAGGAAGGGATCTGTGATTTTCCAGGGTGTTCCGGGGCCTCGAGGTCATCCCTCATGTGCTCTGTACCTTTTGGGGGTGCAGCCAGG
AGGGACCTGGACCCCTGGTTGTGAAGGAGGGAAGACAGAGAAAATGCAACTCTCACCTACTCCTCCGGTTTCAGGGGGCTCACTGTTGAACAGCCCCCAAGGCTCTCCTAGTGTCATGTC
ACTGTGTCCCTGACACCTGTCATGCCCAGTTCTTACCTAGCCCATACGGCACCCTTGGGAAAACTAGAGAAAGGTGTCCCTCTCTGGGTGGACCCATTATAGACCCACCGCAAGGTTCTC
TGCACCCCAATGGACACGGCCCCGGGCCGGGGCACAGGGCTTCGTGAGTGTGGGCCCAGCTCCTTGTGCAGCGTGAGTGGGGCCTCGGAGGCCGCCGGGGTGGGGGCAGAGCCGGGGCAG
AGCTGGGGCACCGGGCAGTTCCTCCTCTGCGCTGTGAGGAGGGCATCACCCGTGTGAAAGCCCCTGGGCTGCCTGAGGGCCCGGAGCCCCCGGGGCTGTGGAGCGGGCGTCTCTGGTGGT
CCTCTTACATCCAGGGGGTGGCTGGAGCCAGCAGATGCCCTCCCAGCCGAGGACAGCCTGGGTGCAAAGTCTGCGGGTGTCCCCACGCAGGTTCTGGTGGGAGAACCCGGGCGTGTTCAG
TAGGCAGCAGCAGCAGGCACTGGCCAGGATCTCCCTGCCCCGAATCATCTGCGACAACACGGGCATCACCACTGTGTCCAAGAACAACATCTTCATGTCCAACACATTCCCTCGGGACTT
TGTCAGCTGTAACACACTCCCCACACTGGACCTGACCCCCTGGAGGGACAGTAACTAG

Retrieve as FASTA