Entry information : KflPrx01 ( kfl00004_0140)
Entry ID 7730
Creation 2010-11-04 (Qiang Li)
Last sequence changes 2014-08-20 (Christophe Dunand)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2016-03-07 (Christophe Dunand)
Peroxidase information: KflPrx01 ( kfl00004_0140)
Name (synonym) KflPrx01 ( kfl00004_0140)
Class Class III peroxidase    [Orthogroup: Prx275]
Taxonomy Eukaryota Viridiplantae Streptophyta Klebsormidiophyceae Klebsormidiaceae Klebsormidium
Organism Klebsormidium flaccidum    [TaxId: 3175 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value KflPrx01
start..stop
S start..stop
KflPrx02 262 2e-86 23..263 27..269
GhPrx01 144 7e-41 63..314 39..308
GmPrx173 143 1e-40 63..324 34..316
GrPrx01 142 3e-40 63..314 39..308
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1..69 69 N° 2 551..653 103 N° 3 1174..1269 96 N° 4 1752..1822 71
N° 5 2177..2239 63 N° 6 2720..2839 120 N° 7 5956..6010 55 N° 8 6357..6435 79
N° 9 6849..6972 124 N° 10 7395..7474 80 N° 11 8081..8216 136  
join(1..69,551..653,1174..1269,1752..1822,2177..2239,2720..2839,5956..6010,6357. .6435,6849..6972,7395..7474,8081..8216)


exon

Literature and cross-references KflPrx01 ( kfl00004_0140)
Literature Timme,R.E., Bachvaroff,T.R. and Delwiche,C.F. Broad phylogenomic sampling and the sister lineage of land plants. PLoS ONE 7 (1), e29696 (2012).
EST ref. GenBank:   HO437950.1 [Fragment]
Cluster/Prediction ref. klebsormidium DB:   kfl00004_0140
Protein sequence: KflPrx01 ( kfl00004_0140)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   331 (305)
PWM (Da):   %s   35549.93 (32707.4)  
PI (pH):   %s   4.89 (4.64) Peptide Signal:   %s   cut: 27 range:27-331
Sequence 372
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAPWTGARFLWLASLLAALTFPQTKAFDLTTGQLFNFAPLPTGSLPNEPLFTPDLRACVFANIQRSLSNLTLSDSQTNARFLRLIFHDCASGGCNGSIMKLQEQKAFVNTFLSGYDKVQIVKAAADAACGSNLSYADTIVAGAFIGVYLSGGPNVTQYVRLGRADTDGLDDPERLPSAFTLNDDLIKTFAVLGLNVEELVALSGAHTLGKATCANVTPRIGGDPYADPQFLYGLTNQCRTLLQQLSMDLSPTQFDTSYYKVMQTGKGILQTDEGLYAENTTRAYTQLFASNQTEFFSSFAVGLLKMSLIGLRPPSVSNVSAGLDRTSEFGA

Retrieve as FASTA  
Remarks Complete sequence from 1 EST and genomic (10 introns). Incorrect prediction from Klebsormidium DB (extra last short exon)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGGCGCCTTGGACCGGAGCTAGATTTTTATGGCTGGCCTCCTTATTGGCAGCACTGACATTCCCACAGGTAAGGGGAGTTGCTTATCAACAGGACGAGTTTTCGATTTTTTGCGCCGAGT
ACAAGTTGTTTCCGCTGCTTCACATGGATATTCGTTGAAACTGTGCAAGATGGGCATAGTGGGGGACTTTACTTACGGGTGTGAAATGATAGGCAATCGCCATGCACTTTTCTGGTGCAT
GCGGTCCTGTTTGCCTGGCAACTGATCAATCGAGAATCTGGGGAGTCCCCTCCTGAAGACTTAGCTGAGGTGGTCATTGCGATTGTTCGTGAAGCTGCAGTGTTTGGAAACTTGAACGGC
TTGTGCATCTTATCTAGGTCGTGCAAGAGCATCACGTTATCATATTACAGTGAGTGGGGAAAGGATAGAAGGTACATTTGATAAATGAGGAATCCCCTTCCGACTTCTTGGAAACGGAAT
ATGGCTATCCAAAGCACCACGCGTGGATCCAACAGAGCCCCAAAAGTTTGCCTTTACTTCCTTGTGCAGACCAAAGCGTTTGACCTGACAACCGGACAATTGTTTAATTTTGCCCCTCTC
CCAACGGGGAGCCTTCCAAACGAGCCCCTCTTCACCCCAGATCTACGAGCAT
GTGAGTCGGCTTGTTTCCCATCATTCGGCTTTAAAGTTTGGATAGTTCTGCCCTGGAGGCGCACGAGT
ACGATTCATATCTGCTCAAAAGCTTGCCAAGAGACAGAAAGTGAAGCACTGGTAGTCCCCCATGCCACTTCCCTTGCTTTCATGGGTTGGAACTCGATGAATCTGTGGGTTTTGACGCCG
AGGTTATCTGTGAGGCAAGAGATTTTCTTACTACCGCAGGAGATTGTCGTCTTTGCCGAGGTCAGTTGTACATCCAGAAAGTTTGCCAACATCTTTTCAGTCGCACCATGTACGTTCCAT
TTGATCTTAAGCATTGCTGCGCCTTCTCAGGAAACGAATATCCCAAGGTCTCTCTCCAGCGGCGCACATCCTTTGTGATGTGACTGATTTTTCTGCAAAATTGGTGATCACGTGCTTTTC
AGAGCGACCGCTAGAGCGAAGCTTCGGCGAAAGGCAGGTTCACTCAGTAGGTCTTCCGTGCCATCTTAACCTCTTTTCACCCGTTTTTGCAGGTGTTTTTGCAAACATCCAAAGGAGCCT
ATCCAACCTGACACTGTCAGACTCCCAAACCAACGCAAGGTTCTTGAGATTGATCTTCCATGACTGCG
GTAGGTTCCGAGCTCTGGTTCCAAAATCACCCCATTGCACTAAACTCCCTGT
ACAGCCTTCCGTTTGCTGACCAGTAATACTCTCGGGGCTGCTTCTGGTCGGGTCCTGTGAGCGAGTGCAGGGGCATGCACGGCCTCCAAAATCACACATCTTGGTCGCTTCAATTGCTTA
TCGCAATTCATCTAGCAAAGGATCTACAACTCGTGTGAGTCGAAGTGCATACGTGGCCTCAGGTTGATTTGGTAGATATGCTGCTTGATCTTCTGCCTGGTCCTTGCTTCTCAGTAAAGT
CCCAGCGACTCGAGAGCACTTGTTGGCTTGAACAATCGTAGCAATCGTGAATCGTCACTCAGTGGCACCTGCTTGAGCCCTATGTTGCGAAGAGCCAGGATCTGGGAAGGCTTTGTAGAG
TGTAAATATTGCTGACACCCCCTGACAATGATGCGACTTCGAAATGGCACGTGTCATCATCTCTTTGCAGCATCGGGCGGGTGCAACGGGTCGATCATGAAGCTACAAGAACAGAAGGCC
TTTGTCAACACTTTCCTGTCG
GTAAGTGTGCCCACTGACCGGAATACATGGTTGATTTGGTCTTCAGCTGCACGATTCAAGCGCAGGCCTGTGTCTTATGCCAGCGGTCGGGTTCCGTTT
AATTTCCCGCTAGTAAGTTTGGGATAGGCATATGGATTCGTCACTGGTGTGGAAGTCCTTCTCTGGAAATCTCTGCTCTTGTAAGTTGACAGGCGATCTTGTCAGCCGTTCAATGCGTGA
CCTAGTATGCGCAGTGACTTCTGCTTTGTACGCTCGCCGCTTGTCTCTCCCAAGGCTTTCGTTGTGACTGCTCTATTCCAAACGCCGCGAAAATCAGGCCTCAGGCTGACCACATTTCAA
GTGGCTCTTTTTCAGGGTTACGACAAGGTCCAGATCGTCAAAGCTGCAGCGGACGCCGCCTGTGGCTCCAACCTGTCTGTAAGTCTCTTCTCCAACGTCCGATATTAAAACTGTCCGTGG
AACGAATCTGAAGAAGCCGGTTGAGCGATATTGCGAGGTGATGGTATTGTGAGATGATAGTAGAAGGAGTCAGGTATTTTGTTGCTGATTCCTGGCAGGGTTGGAGTGCGTTTTGCGTGC
CTGCGGTTCAGCGTGATTCATCTTGGCGAGTTTCCGCTACGTTGTTGGTCGGGCACAAGTTCGCTCAGGCAAGGAGGTTGATCCTGCGCAATTGCCGTATGACAGACACCAACGAATCCT
TCATTTCAGGTCTCTCACCATTTCATGGGGACACCTTCTCAAAAGTCGGTCATCTGGTTCTTGACCAGGACTTTTTCCGGATGTCTCTAAACGAGGAGCAAATGAGATTCATACGCACCG
GAGACTCCTGTCTTGAGTGTTTTTGAAATCGTTTTCAGAGTACACACTCACTCTTGTGTCTCCTTTTCTTTCGGACAGTATGCGGACACAATCGTTGCTGGGGCGTTCATTGGGGTGTAC
TTGTCCGGTGGTCCGAACGTCACGCAGTACGTCAGGCTGGGGAGAGCTGACACCGACGGGTTGGACGACCCGGAGAGG
GTGAGCGCTCCGATGAAAACGTCTGATTGTTCAGTCCTGTTT
CTCGCTAGCGGCCTTTGATCATTTGATGTGGATTGTTATCCACGTACTTGTATCCAACGCTGATTGGAGAGCTAAGCCCCATGCCTTTGATGGACACGGGCTGTGGATGAGGATTTCCCA
GCTAGGCTTCGTGTAGATTCCGTCCTTTGATGCGGCCGCTGTGCAATGGCGTCGCAAGGCATTTGACTTGTCGCCTCATTCTCTTTAAGCTTAGCTGGAGCCGTGGTCGCTCTTTGCTTG
CTAGCTCAGGGTTCCCCTTTATTTCTGTATCTCCTTCTGCTTCCGATTATCTTTCCTTCTTTGTCGTCTTCTGCTTCGCGAGCCGTTACACTTCATTGCCTCTTTTCAAGTTTTCTGTTG
GGCAACGTCCCTTTCTTGCATAAAACAGCAAGGATCCGGCTTTTATGTCTACCTGAGGGTATGCCCGCTTGAGCGTGACGAAAGCATTTTCTGCTCCCCCGTGTTGGAACTCTAAAAAAT
TGCGATCTATCAATCGACGGGAAGCACTGTAACGCGAGTTCGTCAATTTTTGCATTTGCCAGCCAGCTGTCAAAGTTTTTATCAACGGGTGCTGTCGGATTATGAAGTCCGTTCAACTCA
GTCGTCTGGTTGCGGCAGAGACAATGCTATCATCGATATAGAGACTTTCTCATTATTTGCGGTGCTTGTACGTCATGCTGGACCGCCAAGATGGTCGGGTGCTTATTTTGGCTAATGGTT
TAGAGTACGTCCCACGCTCCGTGCCTTGTTTTGTTGCTGAACCGCCTGCGTCTAGGTCGACTCTCAGCGGTTATGAGCACTACTGGTTATGACGACTTCCTGCACAATCTTGGCGCCTGA
GCTTGGCCTCTTTCCCCCGAAGGCTATTTGGATTTGGCACCACCTTTTGAGCTTCTGCTTCCTTATACTACTAGTTGAACGAGGAAGGGTGGAGGTACGTTGCTTTACAAACAGGCCACG
AGATTTATAATGGATTGTAATCGAGGAGTGGAAGTTCAAGCTAGAGCAGCGGTTGGCGTCTGCAATGTTGAGTTGTGCGTTTGTTTTCAACAACATCAACTATGGGAGCTTACATCTAAT
GTCGAGATACTATGCAGATGTGGCACGGGCACTGAGGATCTAAAGCGCCGAGCTCTCCTGCGAAGGGAGTTTACGGCTTGTTTTTCTGAGCCGCTTTTTTGTAACGCTTAATTCCTTGAC
GTCCTTAAAAGGCGAAGGTGTCGAACAAGCGAGTCCCAGCGTAATGGTTCGGGGACCTTTTGTTCTCATCCAAAGCCCGAGTCACGCTGGTCGTCGATCTGAAATGTTCCACTGAAAATC
TTGAGGCCTTCGAACGATTTCCCATTCGATTCTTTGCCCAGGAAAAGCTGCCAATAGTAAGTGGTAATGAACGTCGGTTCTTATCGGACATCAACGGCGTGTTATTCCAGATGGCACTGT
AGCAGCAGCGACGTAGGCTAAGGCTAGGAGGATTGAGTGTGTGGGCTGATTCAGTTCCATACATCCTTCTAATGATCCTGAGCCAGCGTGCATACAGAATGTTGCAGTCTCCTTATCTCT
CGTATCTTTGCAACCCACTTCGCAACCTGAGCGTCGAATACTGCCGACTCAACGGTATTGGACCGATGGTGCACGGGCTATGAGCATCTAGCAAGTTGTCTCGCTTGTTGAGACACAGTT
TTTGATCTACGCAAGCCTGATACTAAGATACTGACTCAGTTGGATTGGGGCTCACAATCACCCACTGTTGGCTTTATTCAGAGCGTGATATACGGAAACAAGGAGGTGCATAGGAAAAGA
CACGTTGCAGCGTTAGGCTGGCTTGAAGTGTCGCTTCAAGGGAGCTTCTTGGCGGACCTTTTTTCGCTTCTGATAGCGTGCTCGACGCGTTTCTCTTCTGAGCAACTCTTCCTTCCATAG
GTCGTTTTGTGCGGTTGATTGGTATTTCAAGGCACTCATTCCCTCATCAGGGTGTCGCTTTTGATATGGTGAATGTTCCTGGCTGCACAAGTCCATTTTGACAGTACTGGGGGTTGGTAC
GTTCAAGCACTTGGGTCAGGGGGCTCGTACGCTCTGGTTTGCATTCTGGAACAGCCTTGTGTTGAACTTTGTCTCGATGCAAGTCTTTTCTCAGCGATGTTTTGATTTCAACGGCAGTTT
GTCTCGAGCCATGCCTGTCTTGAGGTCTCGTGTGCTCCCTTCAGACTTCAATCATGCAATTCGTTGTTGTGAGTTGAGCATCTGAAAATCGCTTTGTTTGAAGATTTTCAGTATGTGGTC
ATGGAATTTGCCTCGGTCTACTTCCTCATCTGTGCCCTCATTTGCTGGGCCAGTGACGCAGGGATTGGATTTTCGGAACGTTCAAACGGCTCAGGGTGGCACTTCCGCTCCCTACAAGAG
CATTCTCCACCCTATTCCGTTCCTCAAATGGGAAGCTTGCTTATCGTCGCTATTGCAGTTTCTGCTGATCATCCGAGTCAACGAGGCGCTTTCTCACGATGCCAGCTTCTTTGTAAAGAG
GATTGCTCCTGTACTTTAAGCTACTGTAGGTGGATTCGGGTCCTTACTTTCAACAGTGGCAGAGACTTCCATGTGCATTCGATATTGGAATACTCAAAAGCTGTGAAGCAAATAGTCCCG
TTTGAACGCCACTCCTGGTCGTCACAGCCAGCAAGAAGGCAATGAAGCTGTCAACGTTGACATCTGTTGTTGGGGCACCATCGAGCCACGTACCGACGTAGTTTTTTTCGATTTTGAGAA
ACCAGACTTCTTTTACTGTTTCCTGTGATGTGTCCTTGGTCCAGCTTGCGGATTTTTGACATTTTCTTTGCCGGTCTCCAAACATCGATGTCCTCCCAGGGATGTTTCAACGTTGGGGTT
CGATCCTTTATGATGTTATTCATGGCGTGTAAGGACCGGCGACTATTCTAAGATGATACGCAAGATGGTAAGCACATCAATGGAACGCACAGTGTCAATATTCTGTTCTGCAGAGGGTTG
TGCTGCGGCACACACAGTCCTCTTGCAATGCTTTGATGCAGAACATCTGGTTGACAAATTCTCCCTGCTTACAGCTGCCGTCGGCGTTTACCTTGAACGACGACCTGATCAAGACCTTTG
CCGTGCTCG
GTAAGCTGTGCGGATATCTTAGGATGTCTCTTGATGCCGGTTTGACTCGAGAATTCGCAGTCCTTCGAGACATTCGTACAACGCTTGACCTTCTGAAACCACGATCTTGGG
GGCCGCGATTGCTAGCTTGATTTTGAGCCTCCCTTGAACCCTCCAGAAAGTCACTCAAAAAACGCCGCAGGATTTGCACTTATGACAGGTAATCTTGAGCTTCTTCCTCAATTGAGGACT
GACAGCATGCAAAAGGCTTGTTTGGTAAAAGTCGGCTATGCTTCGATGCTCTGAGCACGGCAGACTTGGCCCTTGTGGTGCCCTTTTTCAAACGCGTTTTTCGGCGTTTCTGCAGGTTTG
AATGTGGAGGAGTTGGTCGCCCTCTCCGGGGCCCACACGCTCGGGAAGGCGACGTGCGCCAATGTCACGCCAAG
GTGAGGCGGTTCATGACACGTTGCTGGACGATCTAGGGGGCCCAAC
GAATCGAGGTGTCACAAAAAGAACACGTTTTCTTTTGAATCGCAGTTGTTTTCCTTTTCGAATGACTGGCATAGCCTTTCAGGACCGAGGGCGGCCGTTTCTGCTTGCGAAATAGTTTTG
TTAAGCCGCCCCACTCATCGTTCGACGGGACGCTCATACTTTTTTCTCCCGCAGACTCGTAGCATCATTTCGCGCTTCACAAGTTGCTTATCAAGTCGCCTTTTTGGTAATCAAACCGAA
AGCACTTACATTCAACTTCAGATCGCCCCTTTCAGCGTTTTTCTTGATCACGCAGTGGTTATCCAGACGTCTCTTTGCGCGGAATCCCGTGAGAGCATTTGTTTAGCAGATTTTCTGGTC
TGTGCAGGATCGGCGGGGACCCATATGCGGACCCACAGTTTCTGTACGGCCTGACCAACCAGTGCCGGACGTTGCTGCAACAGCTGTCCATGGACCTGTCGCCGACCCAGTTCGACACCA
GCTACTACAAG
GTAAGCTATGTTTAAGAAAGTCTTTGTTGTTGTTTACCTGCTCTTGGAGCTAAGCGTGACAGAAGGGGCGCCGGATTTGAAGTTGTATTTGCCTTCCATTTGACATCGT
AATGAAGCCTGATGTTTGCAAAGCTTCTGCGTCGGCGAATAGTGTGTACTAAAAGCTGACCAAGTAGAGATGAGTCAGTGTACGGACGTGTACGTCGCCTTGAGCAGCGGTGGTGCAGGG
GTTCTGGATTTCAGCAAGCTACGTGCTGCTTGGAATGGGCGAACTTACGAGACCTTATCAGAGATTGAATCTTTAGACAGAGCCCATTCTTTCGTCCGGTCAAGCATCAAAAGCTCTCTG
AAGGCCGGTAGACTATTCTGACCGACCAATCGTCTCTTCGGTTGACGAGGCCTCTGCTCTTGCTCACTTTCAGGTGATGCAAACCGGGAAAGGCATCCTGCAGACCGACGAGGGCCTCTA
CGCCGAAAATACAACCAGGGCATACACCCAATT
GTAAGTATCCGGCGCGAGCTGTCGTTCAGAAGCTTCCTACATCTCCTTTCCATTGTCGATGTATTCTGATTTCGGCAGCGGGGATTT
GCGGAAGATTGTTTTGCGCCAGTCCAATCCTTTCACCCGCTCACTTGGATTGTGGAGCCGTTCCGTGGCATATTATCGCCGAGTTGTAATGGCCAGAGTACCGAAAGGGCCACAGAATCG
GTTCAATCAAGCAGATACAGCAAGCTTTTCTAATCCGCTAAATGGCAAGCCGCTCAAAGAGGTTCTTCAGCGAGTTCCACGTCCCAAGCGAGCAGTACTGCGTCCGCCTCCCTTGTCACT
TCTGTTGTCAAACCGACGAAATGGGTGCCGCGTTTGAGTTTCCACCGAAGCCTGACTGTCGCGCTCGAACAGTGAATGAGTACCCTTTGCCCTCTCAATCTTTCGGAGACTAGCGCTTTT
CACTGCGCTGGAAAGAAAGGTCTTTTCTTGTGTTGATCTGTAACCTAGCACTAGCCACACCGAGTTTCAGATTTCTTTGTACGGTTCATGTTGATCTGACCGAAGCTGACACTCGAAAAT
TGCAGGCCTGACGCTGAGCAAGTGCTGGTTATGCTGCAGGTTTGCCAGCAACCAGACCGAGTTTTTTAGCTCCTTTGCGGTAGGGCTCCTCAAAATGAGCCTTATCGGTTTGCGGCCGCC
CAGCGTATCCAACGTCTCGGCGGGGCTGGATCGAACAAGTGAGTTCGGTGCTTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGGCGCCTTGGACCGGAGCTAGATTTTTATGGCTGGCCTCCTTATTGGCAGCACTGACATTCCCACAGACCAAAGCGTTTGACCTGACAACCGGACAATTGTTTAATTTTGCCCCTCTCC
CAACGGGGAGCCTTCCAAACGAGCCCCTCTTCACCCCAGATCTACGAGCAT
GTGTTTTTGCAAACATCCAAAGGAGCCTATCCAACCTGACACTGTCAGACTCCCAAACCAACGCAAGGT
TCTTGAGATTGATCTTCCATGACTGCG
CATCGGGCGGGTGCAACGGGTCGATCATGAAGCTACAAGAACAGAAGGCCTTTGTCAACACTTTCCTGTCGGGTTACGACAAGGTCCAGATCG
TCAAAGCTGCAGCGGACGCCGCCTGTGGCTCCAACCTGTCT
TATGCGGACACAATCGTTGCTGGGGCGTTCATTGGGGTGTACTTGTCCGGTGGTCCGAACGTCACGCAGTACGTCAGGC
TGGGGAGAGCTGACACCGACGGGTTGGACGACCCGGAGAGG
CTGCCGTCGGCGTTTACCTTGAACGACGACCTGATCAAGACCTTTGCCGTGCTCGGTTTGAATGTGGAGGAGTTGGTCG
CCCTCTCCGGGGCCCACACGCTCGGGAAGGCGACGTGCGCCAATGTCACGCCAAG
GATCGGCGGGGACCCATATGCGGACCCACAGTTTCTGTACGGCCTGACCAACCAGTGCCGGACGT
TGCTGCAACAGCTGTCCATGGACCTGTCGCCGACCCAGTTCGACACCAGCTACTACAAG
GTGATGCAAACCGGGAAAGGCATCCTGCAGACCGACGAGGGCCTCTACGCCGAAAATACAA
CCAGGGCATACACCCAATT
GTTTGCCAGCAACCAGACCGAGTTTTTTAGCTCCTTTGCGGTAGGGCTCCTCAAAATGAGCCTTATCGGTTTGCGGCCGCCCAGCGTATCCAACGTCTCGG
CGGGGCTGGATCGAACAAGTGAGTTCGGTGCTTAG

Retrieve as FASTA