Entry information : ZmPrx73
Entry ID 783
Creation 2006-06-05 (Christophe Dunand)
Last sequence changes 2014-01-16 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2014-03-27 (Christophe Dunand)
Peroxidase information: ZmPrx73
Name ZmPrx73
Class Class III peroxidase    [Orthogroup: Prx038]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Zea
Organism Zea mays    [TaxId: 4577 ]
Cellular localisation N/D
Tissue type Roots
Inducer Drought
Repressor N/D
Best BLASTp hits
Perox score E-value ZmPrx73
start..stop
S start..stop
SbPrx33 533 0 1..364 1..361
SiPrx118 451 5e-160 1..364 1..357
BdiPrx17 384 2e-133 1..364 3..348
OsPrx102 364 6e-126 48..363 31..345
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 150020888..150021226 339 N° 2 150020466..150020817 352 N° 3 150019939..150020342 404  
complement(join(150019939..150020342,150020466..150020817,150020888..150021226))


exon

Literature and cross-references ZmPrx73
Literature Bohnert,H. et al., unpublished
DNA ref. GenBank:   AC184048.4 (100141..101425)
EST ref. GenBank:   CF626044 [3' end]
Protein sequence: ZmPrx73
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   365 (338)
PWM (Da):   %s   39201.68 (36303.1) Transmb domain:   %s   i7-29o
PI (pH):   %s   8.24 (7.73) Peptide Signal:   %s   cut: 27 range:27-364
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MRTPRGVSSSFLALYGFLLLVAVSVAATGYAASPGESSNGYGAAAGSNGGGQEGSYTVPPYQKSVDGLDERYYERSCPKMEEIVGTAVMKAVKADETLAASIIRLFFHDFAVGGVDGSVLVDVPGQSEKYAEASRTLRGFELIEGIKKEVEAKCRATVSCADILTAAARDAAFSAGAPYWSLKYGRRDRKDYSSAEAADRDVPMGGQRVTELVAFFDTKGLNIQDLVALSGAHTIGRATCGSVRPGLCKRRKARTLDRQYGDFLQRKCRAGGDAAEAYVELDGETPTAFDNQYYKNLLHGKGLLDTDQALLADSRTAGFVKSFAYQKPQEFAHQFAKSMRRLGEAQVLTGNEGEVRRKCSAVNY*

Retrieve as FASTA  
Remarks Complete sequence from 1 EST and genomic (chromo 7, introns 1 and 3). Missing cystein residues. Containing motif FHDC.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGGACGCCGCGGGGTGTCTCGTCGTCGTTCCTTGCCCTCTACGGGTTCCTTCTCCTCGTCGCCGTCTCGGTGGCCGCGACCGGCTACGCCGCTTCGCCGGGGGAGAGTTCCAACGGT
TACGGCGCTGCAGCCGGTTCGAACGGCGGCGGCCAGGAGGGAAGCTACACGGTGCCGCCGTACCAGAAGTCCGTGGACGGCCTCGACGAGCGGTACTACGAGAGGTCGTGCCCGAAAATG
GAGGAGATCGTCGGGACGGCCGTGATGAAGGCCGTGAAAGCCGACGAGACCCTCGCCGCCAGCATCATCCGCCTCTTCTTCCACGACTTCGCCGTCGGG
GTACGTACGTACGTGTGTATC
TTTCGTTGGTGGTCGGCGAATATAATTGACATGGTGGTGTGTGGTGCAGGGCGTGGACGGGTCGGTCCTGGTAGACGTGCCCGGGCAGAGCGAGAAGTACGCGGAGGCGAGCAGGACGCT
GCGCGGGTTCGAGCTGATCGAGGGGATCAAGAAGGAGGTGGAGGCCAAGTGCCGCGCCACCGTCTCCTGCGCCGACATCCTCACCGCCGCCGCTCGCGACGCCGCCTTCTCGGCCGGGGC
GCCCTACTGGTCGCTCAAGTACGGGCGCAGGGACAGGAAGGACTACTCCAGCGCCGAGGCGGCCGACCGCGACGTCCCCATGGGCGGCCAGCGCGTCACCGAGCTCGTCGCCTTCTTCGA
TACGAAGGGTCTCAACATCCAAGACCTCGTCGCGCTTTCCG
GTGAGTCGTGAGTGCGAGAGCAATGCATATATCGATCGATCGATCGTTCGCGCGCGGACACACACACGCACACACATGC
TTGTTAATGCTAACAGTGACGACATGCATGCACTATATATGCAGGAGCTCACACGATCGGGCGCGCGACGTGCGGATCCGTGAGGCCGGGGCTGTGCAAGCGCCGGAAGGCACGCACGCT
GGACCGGCAGTACGGCGACTTCCTGCAGCGCAAGTGCCGCGCCGGCGGCGACGCGGCGGAGGCGTACGTGGAGCTGGACGGCGAGACGCCCACGGCGTTCGACAACCAGTACTACAAGAA
CCTGCTGCACGGGAAGGGGCTGCTGGACACGGACCAGGCGCTGCTGGCGGACTCCCGGACGGCCGGGTTCGTCAAGTCGTTCGCGTACCAGAAGCCCCAGGAGTTCGCCCACCAGTTCGC
CAAGTCCATGCGCCGCCTCGGCGAGGCGCAGGTGCTCACCGGGAACGAGGGCGAGGTCCGCCGCAAGTGCTCGGCCGTCAACTACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGGACGCCGCGGGGTGTCTCGTCGTCGTTCCTTGCCCTCTACGGGTTCCTTCTCCTCGTCGCCGTCTCGGTGGCCGCGACCGGCTACGCCGCTTCGCCGGGGGAGAGTTCCAACGGT
TACGGCGCTGCAGCCGGTTCGAACGGCGGCGGCCAGGAGGGAAGCTACACGGTGCCGCCGTACCAGAAGTCCGTGGACGGCCTCGACGAGCGGTACTACGAGAGGTCGTGCCCGAAAATG
GAGGAGATCGTCGGGACGGCCGTGATGAAGGCCGTGAAAGCCGACGAGACCCTCGCCGCCAGCATCATCCGCCTCTTCTTCCACGACTTCGCCGTCGGG
GGCGTGGACGGGTCGGTCCTG
GTAGACGTGCCCGGGCAGAGCGAGAAGTACGCGGAGGCGAGCAGGACGCTGCGCGGGTTCGAGCTGATCGAGGGGATCAAGAAGGAGGTGGAGGCCAAGTGCCGCGCCACCGTCTCCTGC
GCCGACATCCTCACCGCCGCCGCTCGCGACGCCGCCTTCTCGGCCGGGGCGCCCTACTGGTCGCTCAAGTACGGGCGCAGGGACAGGAAGGACTACTCCAGCGCCGAGGCGGCCGACCGC
GACGTCCCCATGGGCGGCCAGCGCGTCACCGAGCTCGTCGCCTTCTTCGATACGAAGGGTCTCAACATCCAAGACCTCGTCGCGCTTTCCG
GAGCTCACACGATCGGGCGCGCGACGTGC
GGATCCGTGAGGCCGGGGCTGTGCAAGCGCCGGAAGGCACGCACGCTGGACCGGCAGTACGGCGACTTCCTGCAGCGCAAGTGCCGCGCCGGCGGCGACGCGGCGGAGGCGTACGTGGAG
CTGGACGGCGAGACGCCCACGGCGTTCGACAACCAGTACTACAAGAACCTGCTGCACGGGAAGGGGCTGCTGGACACGGACCAGGCGCTGCTGGCGGACTCCCGGACGGCCGGGTTCGTC
AAGTCGTTCGCGTACCAGAAGCCCCAGGAGTTCGCCCACCAGTTCGCCAAGTCCATGCGCCGCCTCGGCGAGGCGCAGGTGCTCACCGGGAACGAGGGCGAGGTCCGCCGCAAGTGCTCG
GCCGTCAACTACTAA

Retrieve as FASTA