Entry information : BdiPrx48 (Bradi1g77130)
Entry ID 7842
Creation 2011-01-12 (Toky Ramarohetra)
Last sequence changes 2011-01-12 (Toky Ramarohetra)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2014-01-08 (Qiang Li)
Peroxidase information: BdiPrx48 (Bradi1g77130)
Name (synonym) BdiPrx48 (Bradi1g77130)
Class Class III peroxidase    [Orthogroup: Prx149]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Brachypodium
Organism Brachypodium distachyon    [TaxId: 15368 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value BdiPrx48
start..stop
S start..stop
OsPrx34 444 6e-158 28..338 25..322
OsPrx33 364 2e-126 11..336 11..329
ZmPrx28 362 8e-126 26..338 25..329
SofPrx03 358 2e-124 28..338 30..330
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 73499969..73500190 222 N° 2 73500315..73500512 198 N° 3 73500602..73500767 166 N° 4 73500863..73501293 431
join(73499969..73500190,73500315..73500512,73500602..73500767,73500863..73501293 )


exon

Literature and cross-references BdiPrx48 (Bradi1g77130)
DNA ref. Phytozome 12:   Bd1 (73499969..73501293)
EST ref. GenBank:   DV469618.1 [Fragment]
Protein sequence: BdiPrx48 (Bradi1g77130)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   338 (316)
PWM (Da):   %s   34638.01 (32411.9)  
PI (pH):   %s   4.73 (4.72) Peptide Signal:   %s   cut: 23 range:23-338
Sequence 379
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAVLVLAAAVLWLCCAGRDAQAQAPATQLQLGFYAQSCPQAEVIVRDEVGRAVSGDPGLAAGLLRLHFHDCFVKGCDASVLLDTIAGNGSTAAEKDAAPNRTLRGFEVIDGAKKRLESACAGTVSCADILAFAARDSVVLTGGSPYGVPAGRRDGNESSASDAQASLPPPTANVAQLTQIFARNGLSQEDMVTLSGAHTIGVTHCSSFSARLYSGDNNNSDNTGHDPAMDDATATELARRCPPGSADTVPMDLGGGGGPVDENAFDTGYFQALLAHRGLLGSDQALTADNATAALVAQNAGNLYLFVTRFADAMVRMGAVRVLTGSDGQIRTSCRVVN

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 1, intron 1, 2 and 3), 1 EST. Cultivar="Bd21".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGGCGGTCCTAGTACTAGCTGCCGCGGTGCTGTGGCTATGCTGCGCCGGTCGGGACGCGCAGGCGCAGGCGCCAGCAACGCAGCTGCAGTTGGGGTTCTACGCGCAGTCTTGCCCCCAGG
CGGAGGTCATCGTGCGGGACGAGGTCGGCAGGGCCGTCTCCGGCGACCCCGGCCTCGCCGCCGGGCTCCTCCGCCTCCACTTCCACGACTGCTTCGTCAAG
GTTTCTACTTTCTACTCTT
CCATTTCACCTTGAAATGCCAATGTCAATGCCAGTGCAACGCAGGCTTGTCTGTCTGTCTCAAAATGTCAGCGATGATAGATGTGCTACTGCTGATGATGTGCAGGGCTGCGACGCGTCG
GTGCTGCTGGACACGATTGCGGGCAACGGCAGCACGGCGGCGGAGAAGGACGCGGCGCCGAACAGGACGCTCCGTGGGTTCGAGGTGATCGACGGCGCCAAGAAGCGGCTGGAGAGCGCG
TGCGCCGGCACCGTCTCCTGCGCCGACATCCTCGCCTTCGCCGCCAGAGACAGCGTCGTGCTG
GTACGTGTACGCCCGTGACTCTCCATTAATCGCTGCAACGAACGAAGTCCCGTAGTC
TCTTTAATTTGCTTACGTATCGACAATGGCAGACCGGCGGCAGCCCGTACGGCGTGCCGGCGGGGCGGAGGGACGGCAACGAGTCGTCGGCGTCCGACGCGCAGGCCAGCCTGCCACCTC
CCACCGCAAACGTGGCCCAGCTGACCCAAATCTTCGCCAGGAACGGGCTCTCCCAGGAGGACATGGTCACGCTCTCCG
GTACCCTATAAAGCCCATATCATATAAAACGGCCCAAAGCCC
AACTAAACCAATCAGATTCTGAATCTTTTTTTTCCTTCTTTTTTTGCATTCAGGGGCGCACACGATCGGGGTGACGCACTGCAGCTCATTCAGCGCGCGGCTCTACTCGGGCGACAACAA
CAACAGCGATAACACGGGCCATGACCCGGCCATGGACGACGCCACGGCGACGGAGCTGGCCCGGCGGTGCCCGCCAGGGAGCGCCGACACGGTGCCCATGGACCTCGGCGGCGGCGGCGG
CCCAGTCGACGAGAACGCGTTCGACACGGGCTACTTCCAGGCGCTGCTGGCCCATCGCGGCCTGCTGGGCTCCGACCAGGCCCTCACGGCCGACAACGCCACCGCGGCTCTCGTGGCCCA
GAATGCCGGGAACCTGTATTTGTTTGTCACCAGGTTCGCCGACGCCATGGTCAGGATGGGCGCCGTCCGGGTGCTCACCGGCAGTGACGGCCAGATTCGCACCAGTTGCAGGGTCGTAAA
CTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGGCGGTCCTAGTACTAGCTGCCGCGGTGCTGTGGCTATGCTGCGCCGGTCGGGACGCGCAGGCGCAGGCGCCAGCAACGCAGCTGCAGTTGGGGTTCTACGCGCAGTCTTGCCCCCAGG
CGGAGGTCATCGTGCGGGACGAGGTCGGCAGGGCCGTCTCCGGCGACCCCGGCCTCGCCGCCGGGCTCCTCCGCCTCCACTTCCACGACTGCTTCGTCAAG
GGCTGCGACGCGTCGGTGC
TGCTGGACACGATTGCGGGCAACGGCAGCACGGCGGCGGAGAAGGACGCGGCGCCGAACAGGACGCTCCGTGGGTTCGAGGTGATCGACGGCGCCAAGAAGCGGCTGGAGAGCGCGTGCG
CCGGCACCGTCTCCTGCGCCGACATCCTCGCCTTCGCCGCCAGAGACAGCGTCGTGCTG
ACCGGCGGCAGCCCGTACGGCGTGCCGGCGGGGCGGAGGGACGGCAACGAGTCGTCGGCGT
CCGACGCGCAGGCCAGCCTGCCACCTCCCACCGCAAACGTGGCCCAGCTGACCCAAATCTTCGCCAGGAACGGGCTCTCCCAGGAGGACATGGTCACGCTCTCCG
GGGCGCACACGATCG
GGGTGACGCACTGCAGCTCATTCAGCGCGCGGCTCTACTCGGGCGACAACAACAACAGCGATAACACGGGCCATGACCCGGCCATGGACGACGCCACGGCGACGGAGCTGGCCCGGCGGT
GCCCGCCAGGGAGCGCCGACACGGTGCCCATGGACCTCGGCGGCGGCGGCGGCCCAGTCGACGAGAACGCGTTCGACACGGGCTACTTCCAGGCGCTGCTGGCCCATCGCGGCCTGCTGG
GCTCCGACCAGGCCCTCACGGCCGACAACGCCACCGCGGCTCTCGTGGCCCAGAATGCCGGGAACCTGTATTTGTTTGTCACCAGGTTCGCCGACGCCATGGTCAGGATGGGCGCCGTCC
GGGTGCTCACCGGCAGTGACGGCCAGATTCGCACCAGTTGCAGGGTCGTAAACTGA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
GACCTTGTTA CTTCTTCTAC CTCTCAGGAT ATATTTCCTC TTCATGTAAA CTTGTCTTGC TCTGTCTTTG ATTCGTCTTG GTAAACACAG AAGCCATGGC GGTCCTAGTA CTAGCTGCCG  CGGTGCTGTG GCTATGCTGC GCCGGTCGGG ACGCGCAGGC GCAGGCGCCA GCAACGCAGC TGCAGTTGGG GTTCTACGCG CAGTCTTGCC CCCAGGCGGA GGTCATCGTG CGGGACGAGG  TCGGCAGGGC CGTCTCCGGC GACCCCGGCC TCGCCGCCGG GCTCCTCCGC CTCCACTTCC ACGACTGCTT CGTCAAGGGC TGCGACGCGT CGGTGCTGCT GGACACGATT GCGGGCAACG  GCAGCACGGC GGCGGAGAAG GACGCGGCGC CGAACAGGAC GCTCCGTGGG TTCGAGGTGA TCGACGGCGC CAAGAAGCGG CTGGAGAGCG CGTGCGCCGG CACCGTCTCC TGCGCCGACA  TCCTCGCCTT CGCCGCCAGA GACAGCGTCG TGCTGACCGG CGGCAGCCCG TACGGCGTGC CGGCGGGGCG GAGGGACGGC AACGAGTCGT CGGCGTCCGA CGCGCAGGCC AGCCTGCCAC  CTCCCACCGC AAACGTGGCC CAGCTGACCC AAATCTTCGC CAGGAACGGG CTCTCCCAGG AGGACATGGT CACGCTCTCC GGGGCGCACA CGATCGGGGT GACGCACTGC AGCTCATTCA  GCGCGCGGCT CTACTCGGGC GACAACAACA ACAGCGATAA CACGGGCCAT GACCCGGCCA TGGACGACGC CACGGCGACG GAGCTGGCCC GGCGGTGCCC GCCAGGGAGC GCCGACACGG  TGCCCATGGA CCTCGGCGGC GGCGGCGGCC CAGTCGACGA GAACGCGTTC GACACGGGCT ACTTCCAGGC GCTGCTGGCC CATCGCGGCC TGCTGGGCTC CGACCAGGCC CTCACGGCCG  ACAACGCCAC CGCGGCTCTC GTGGCCCAGA ATGCCGGGAA CCTGTATTTG TTTGTCACCA GGTTCGCCGA CGCCATGGTC AGGATGGGCG CCGTCCGGGT GCTCACCGGC AGTGACGGCC 
AGATTCGCAC CAGTTGCAGG GTCGTAAACT GATATAACAG CATACAGACA GTACCATTTT TTCTTTTTGC GAGTTATTTC TTTTTTGTTT CTATGTCTTT CAAAATG 

Retrieve as FASTA