Entry information : BdiPrx92 (Bradi2g46050)
Entry ID 7870
Creation 2011-01-14 (Toky Ramarohetra)
Last sequence changes 2011-01-14 (Toky Ramarohetra)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2014-01-08 (Qiang Li)
Peroxidase information: BdiPrx92 (Bradi2g46050)
Name (synonym) BdiPrx92 (Bradi2g46050)
Class Class III peroxidase    [Orthogroup: Prx026]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Brachypodium
Organism Brachypodium distachyon    [TaxId: 15368 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value BdiPrx92
start..stop
S start..stop
SbPrx66 578 0 26..367 33..367
HvPrx25 569 0 1..351 3..343
SiPrx02 563 0 26..367 30..363
ZmPrx137 558 0 48..367 50..369
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 46479307..46479612 306 N° 2 46479782..46480003 222 N° 3 46481892..46482467 576  
join(46479307..46479612,46479782..46480003,46481892..46482467)


exon

Literature and cross-references BdiPrx92 (Bradi2g46050)
DNA ref. Phytozome 12:   Bd2 (46479307..46482467)
Protein sequence: BdiPrx92 (Bradi2g46050)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   367 (340)
PWM (Da):   %s   39192.33 (36387.9)  
PI (pH):   %s   10.1 (9.99) Peptide Signal:   %s   cut: 28 range:28-367
Sequence 408
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MDSSTGIRFVLLLVVSLGGNGMRACRAREAPLPLPLPSAAPATTAGSSRRAPERHGLSLDFYAKTCPAVDQIVANVTAARFRDHPAAGPAVLRLFHHDCFVEGCDASILIAPTAAKAGDAAARAPKVERDMEENKNLPQYGFDTVEMAKAAVESKCPGVVTCADVLALAARDFVQLAGGPYYAVKKGRKDSKVSLAGKVRGSLPRANSTVDDLLRVFASKGLGLNDLVALSGAHTIGFAHCAHFLGRLYDFRGTRQPDPLMDARLVKALRMACPSTGGSARVVVPFDVSTPFQFDHAYYANLQARLGLLGSDQALFLDPRTRPIVQSLGADRARFFQAFVASMDRMGSIRVKKGRKGEVRRICSQHL

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 2, introns 1 and 2), no EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGGATTCCTCCACTGGGATCCGCTTTGTCTTGCTCCTCGTCGTGTCCCTCGGCGGCAATGGCATGCGCGCTTGCCGCGCTCGGGAGGCGCCCTTGCCATTGCCATTGCCGTCGGCCGCTC
CCGCTACTACTGCAGGAAGCAGCAGGAGGGCGCCGGAGCGGCACGGGCTGTCGCTGGACTTCTACGCCAAGACGTGCCCCGCGGTCGACCAGATCGTCGCCAACGTCACCGCCGCGCGGT
TCCGCGATCACCCGGCCGCAGGCCCCGCCGTGCTCCGCCTCTTCCACCACGACTGCTTCGTGGAA
GTACGTAAGCAAATTAGTCAATCTTAGCACGCACGCACATTGCACGATTCTGTTA
CCTGCACCCACAATCTCGGTCACTTTCTTAACGAACGGTCAATTTTTCCTTTCCGTGGCATGCACATTGTTGGTAGTTGGTACCGATGTCTGATCGAACCGAACGAACGTACAGGGGTGC
GACGCGTCCATACTGATCGCGCCGACGGCGGCCAAGGCCGGCGACGCGGCGGCACGGGCGCCGAAGGTGGAGAGGGACATGGAGGAGAACAAGAACCTGCCGCAGTACGGGTTCGACACG
GTGGAGATGGCCAAGGCCGCCGTGGAGAGCAAGTGCCCCGGCGTCGTCACCTGCGCCGACGTCCTCGCCCTCGCCGCACGAGACTTCGTGCAACTG
GTACGCTACGCATGCCTGTACCGG
TTAACCGCTCCCGCCATTATATCTCCTTCTTTTTTTCTCGGAAAAAGGCTGTTCCATTCATGCGACAATGCGCGCGCGGGGCAAGCCTGACCGACCACAAAGCCATTGTTCAAGTACAGT
GCGACTCCTATTACGCAACGCAACCCAGCCAGCAGACTGGCAATTAACGACGGGTTTCAGCGTGCGTAAATAGGAAAAAGCGATGCGAGTACGCGGCATTGCAAGTTTTGCAACTCCCAA
GTCCCAACCGCCCCAAAGGAGGACCAGAGCGAGACTTGACCGGGGCAAAAAGTTTATCTGCTTTGCTTTTAACTTTTGCATGGGGATAAAGGCGCGCGCACCCGGTCCGGCCGCCATGCC
CGCCCGTGCCGATGGGCGGCATGTGACGCCGTGCGAACGGCGTCAGGAGCAAGGCGCATGCTCAGATTACCATGCGTAGCTTAGCCAAGTGCAACAGGATTATCTTTGCCAAGTACGGGC
CGAGCCGGTAAAACAAATGAGACCTGCTCTGTTTTTTTGTTTCCCCCGTGCTGGTGTAAGTGAGAGTAGGTTCTGGATTACGGAGTCACTCGGCTTCAAAAGGAAAAAAAAGAACCTTGC
AAATCAGAATGATCGAGTGGATTGTTTGGGTGATGGGCCCGTTCTAGCTAGGTAGATAAAGCCGATAGCTTGGAGATTCGGTAGTCTCTTGGATCTTATCGTCACAGGACAGCAAATTAA
GATAGGCTCGAATCGTGTCAAAACCAACAGATTTGGTGCTAGCGATAGATATAGGTGCACACTGATTTTCTCCGTCTGTCCCTGACATCCGTCGCTGCTTGTAAGCTAGCTAACCGAACA
CAGCAAGCTGTCTTGAGTAGCTAGGCGCCTCTGAGGCTCTCTGAGCAAGTCAATTGTCCCGTTCTTCTTCCATGGTTCTTTTTCTCTCCCACTATCATAAATCAAGCGTGATGCCTTGGC
TCTTGCATTGTCGTGTACTCGTGTAGCAGGGCCCTCTTCTTTTCTGGACCAGTATTGCGTAGGCCAAAAACTCACAACTCGAAAGGTAGTAATAAATCATAACGCATCGGCTCATCATTT
TTCTCGAGCGTAACGTACATATTCCTAGGAAACAATTTGTGTGCTGGCATGACCAACTTATGTAATATTCATCTTTCCATGAATATGTCAATTATCAAGATGTTGGTAGGCCAGCTAAAA
AAAGATGTTGGTAGGCCAGAAGTTGCAGCGATGTTTCAGCAGGCCCACAGACACTAGGCCGCGTGTGGCTTTAGGCTTGGATAAGAAAAGCCCATCTACGTTAGGTCAGTCCTGCCTAAA
GTCCATGCTATATATGTGGGGTACAAATTGGTGGAAAATACTCCCTCCATTTCACAAAGAATGTCATGCACACATTTCAAAATTTTACTTTGACCAACAATTAGACTAATGATTTAAGAC
TTATGTGTTACAAAAATTATATCATTAGATTCGTATTTTAAAAACCTTTCCAACGATATAAAATTTGTAACATATAATCTACATACAATTGGTCTAATCGTTGATCAAAGTTCGACCTCG
AAAAGCGTTGGCGCCACTCTTTGTGAAATGGAGGGAGTATCTCATGCAGAAAAAAAAAAGTTTCTTACTAGCAGTGATAACGAATTCTTTTGCCAGTTAAATGACCCAGGATCATGGTTT
GCTTTAGGCTTGGATAAGAAAAGCCCATCTACGTTAGGTCAGTCCTACCTAAAGTCCATGCTATATATGTGGGCTACAAATTGGTGAAAAGTATCTCATACAGAAAAAAAAAAGTTCTTA
CTAGTAGTGATAACGAATTCTTTTGCCAGTTAAATGACCCAGGATCATGGTTTGCTTCATGCAGGCAGGTGGGCCCTACTACGCGGTGAAGAAGGGTCGGAAAGACAGCAAGGTGTCCCT
GGCGGGCAAGGTGCGCGGCAGCCTCCCACGCGCCAACTCGACCGTGGACGATCTCCTCCGCGTGTTCGCCTCCAAGGGCCTGGGCCTGAACGACCTGGTGGCGCTCTCCGGCGCGCACAC
CATCGGCTTCGCGCACTGCGCCCACTTCCTGGGCCGCCTCTACGACTTCCGCGGCACGCGGCAGCCGGACCCGCTCATGGACGCCCGCCTCGTGAAGGCGCTGCGCATGGCGTGCCCTTC
CACCGGCGGCAGCGCCCGCGTCGTGGTGCCCTTCGACGTGAGCACCCCGTTCCAGTTCGACCACGCCTACTACGCTAACCTGCAGGCCAGGCTGGGCCTCCTGGGCTCCGACCAGGCGCT
CTTCCTGGACCCGCGCACCAGGCCCATCGTGCAGAGCCTCGGCGCCGACAGGGCCCGCTTCTTCCAGGCCTTTGTTGCCAGCATGGACAGGATGGGCTCCATCCGCGTCAAGAAAGGCAG
GAAGGGGGAGGTCAGGAGGATCTGCAGCCAGCATCTGTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGGATTCCTCCACTGGGATCCGCTTTGTCTTGCTCCTCGTCGTGTCCCTCGGCGGCAATGGCATGCGCGCTTGCCGCGCTCGGGAGGCGCCCTTGCCATTGCCATTGCCGTCGGCCGCTC
CCGCTACTACTGCAGGAAGCAGCAGGAGGGCGCCGGAGCGGCACGGGCTGTCGCTGGACTTCTACGCCAAGACGTGCCCCGCGGTCGACCAGATCGTCGCCAACGTCACCGCCGCGCGGT
TCCGCGATCACCCGGCCGCAGGCCCCGCCGTGCTCCGCCTCTTCCACCACGACTGCTTCGTGGAA
GGGTGCGACGCGTCCATACTGATCGCGCCGACGGCGGCCAAGGCCGGCGACGCGG
CGGCACGGGCGCCGAAGGTGGAGAGGGACATGGAGGAGAACAAGAACCTGCCGCAGTACGGGTTCGACACGGTGGAGATGGCCAAGGCCGCCGTGGAGAGCAAGTGCCCCGGCGTCGTCA
CCTGCGCCGACGTCCTCGCCCTCGCCGCACGAGACTTCGTGCAACTG
GCAGGTGGGCCCTACTACGCGGTGAAGAAGGGTCGGAAAGACAGCAAGGTGTCCCTGGCGGGCAAGGTGCGCG
GCAGCCTCCCACGCGCCAACTCGACCGTGGACGATCTCCTCCGCGTGTTCGCCTCCAAGGGCCTGGGCCTGAACGACCTGGTGGCGCTCTCCGGCGCGCACACCATCGGCTTCGCGCACT
GCGCCCACTTCCTGGGCCGCCTCTACGACTTCCGCGGCACGCGGCAGCCGGACCCGCTCATGGACGCCCGCCTCGTGAAGGCGCTGCGCATGGCGTGCCCTTCCACCGGCGGCAGCGCCC
GCGTCGTGGTGCCCTTCGACGTGAGCACCCCGTTCCAGTTCGACCACGCCTACTACGCTAACCTGCAGGCCAGGCTGGGCCTCCTGGGCTCCGACCAGGCGCTCTTCCTGGACCCGCGCA
CCAGGCCCATCGTGCAGAGCCTCGGCGCCGACAGGGCCCGCTTCTTCCAGGCCTTTGTTGCCAGCATGGACAGGATGGGCTCCATCCGCGTCAAGAAAGGCAGGAAGGGGGAGGTCAGGA
GGATCTGCAGCCAGCATCTGTAG

Retrieve as FASTA