Entry information : BdiAPx05 (Bradi4g41180)
Entry ID 7891
Creation 2011-01-17 (Toky Ramarohetra)
Last sequence changes 2011-01-17 (Toky Ramarohetra)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2011-01-19 (Toky Ramarohetra (Scipio))
Peroxidase information: BdiAPx05 (Bradi4g41180)
Name (synonym) BdiAPx05 (Bradi4g41180)
Class Ascorbate peroxidase    [Orthogroup: APx002]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Brachypodium
Organism Brachypodium distachyon    [TaxId: 15368 ]
Cellular localisation N/D
Tissue type Callus
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value BdiAPx05
start..stop
S start..stop
TaAPx03 605 0 1..314 1..313
HvAPx05 604 0 1..314 1..312
SiAPx06 576 0 1..314 1..311
SbAPx06 564 0 1..314 1..313
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 45349922..45350008 87 N° 2 45350098..45350214 117 N° 3 45350611..45350731 121 N° 4 45350807..45350907 101
N° 5 45351006..45351093 88 N° 6 45351938..45352005 68 N° 7 45352101..45352187 87 N° 8 45352864..45352938 75
N° 9 45353019..45353096 78 N° 10 45353184..45353288 105 N° 11 45353376..45353393 18  
join(45349922..45350008,45350098..45350214,45350611..45350731,45350807..45350907 ,45351006..45351093,45351938..45352005,45352101..45352187,45352864..45352938,453 53019..45353096,45353184..45353288,45353376..45353393)


exon

Literature and cross-references BdiAPx05 (Bradi4g41180)
Literature Vogel,J.P., Gu,Y.Q., Twigg,P., Lazo,G.R., Laudencia-Chingcuanco,D., Hayden,D.M., Donze,T.J., Vivian,L.A., Stamova,B. and Coleman-Derr,D.
EST sequencing and phylogenetic analysis of the model grass Brachypodium distachyon.
Theor Appl Genet 113 (2), 186-195 (2006).
DNA ref. Phytozome 12:   Bd4 (45349922..45353393)
EST ref. GenBank:   DV470194.1 [5' end]
Protein sequence: BdiAPx05 (Bradi4g41180)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   314
PWM (Da):   %s   34298.51  
PI (pH):   %s   7.34
Sequence 355
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAVHHHLLRRGLAGGSPLSPLRGLFLVSQELGRRQASSAAAGDAAAELRGAREDVRQLLKDKHCHPILVRLGWHDSGTYDKNISEWPKCGGANGSLRFEIELKHAANAGLVNALKLVQTIKDKYAGVTYADLFQLASATAIEEAGGPKIPMIYGRVDVSAPEQCPPEGRLPAAGPPSPAEHLREVFYRMGLNDKEIVALSGAHTLGRSRPERSGWGKPETKYTKNGPGATGGQSWTSQWLKFDNSYFKDVKERRDEDLLVLPTDAVLFEDPSFKIYAERYAEDQDTFFEDYAEAHAKLSNLGSKFDPPKGISLD

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 4, 10 introns), 1 EST. Cultivar="Bd21".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGGCCGTCCACCACCACCTCCTCCGCCGCGGGCTCGCCGGCGGGTCCCCCCTCAGCCCTCTCCGCGGCCTCTTCCTCGTATCCCAGGTACGCATGACCAGCTGCTCCCGCCCTCGTCCAT
CACTCCACGCTGACGCGTCGGTTCCTGACCCCTTCTTGGCCTTCCCTCCTCGAAGGAGCTCGGGCGGCGTCAGGCGAGCTCGGCGGCGGCGGGGGATGCGGCGGCTGAGCTGAGGGGCGC
GCGGGAGGACGTCAGGCAGCTGCTTAAGGACAAGCACTGCCACCCCATCCTG
GTATCGTACACACACACACAATCTTGCAATTTTTCATGGAAGAACGATCGCACGTTTTAAGCTTATTC
GAGTTCGAGCAGAGGAATGTCCGCGTTGGGCTTAAGAATAAAGATTATCTTCTGTCAGTTCAGAAATTTTGGTCACTTATGGTTTGCTATATGCTTAGTTCACTTACTTAATATGCTTGT
TATACAAGAGGAGGATGCTGTGAGTACTTATTGGGGCTGGGTGAACTAGTCTGTAGCATGTCCAATGCACAACTTTAATCCACTTGCTGTTCTTTGTTGTATGTGGATGGTCCCTGGTTT
TGCATTTTCTTGATCCAACGTTAAAACTGATGCACTCTCTCCAGATGCCTCTGTATGGCATTGTTTCCTGAACTGCTTCTGGTTTCAGGTTCGGTTGGGTTGGCACGACTCTGGCACTTA
TGACAAGAACATTAGCGAGTGGCCAAAGTGTGGTGGAGCGAATGGCAGCCTGAGATTTGAAATCGAGTTAAAGCATGCCGCTAATGCTG
GTAGTGCTTCTCCCCCTCTTGTAATCTTTTG
CTTCATATGATCAAGGGATGGTTCTTAGACTAATTGTACTGCAGGCCTTGTGAATGCTCTGAAGCTGGTTCAAACCATCAAGGACAAATATGCCGGTGTCACTTATGCAGATCTGTTTCA
GCTTGCCAGTGCTACTGCCATTGAG
GTCCTTCATGGCGCTTCAACCTACTGATGATGATCATCATAAAATGTTCTTTCTTTATATTAGCAATGATGTGATTGAATTGATTTCTCTCTTTT
CAGGAAGCTGGTGGCCCCAAAATCCCCATGATCTATGGAAGGGTTGATGTTTCTGCCCCTGAACAGTGCCCACCAGAGGGGAGACTCCCTGGTTAGTAACTAGTATCTATAACCCAACTT
ACTCTATACGCCAATTTAGCTTATCTGGACATCTGTGTCTAGAGCTAGAATTTTACACTGCACCTTTAGTTCCATATGATATAATTTCTTCATCATATACTAACAAGATCTCAGTGATGG
AAGCTATGAATAATTATCTCGCAAACTTAAATGGATCACCGACCAAAACATTAACTAACAACCTCTCATCAAATTTGGACTGTGTTGTTTCCTAATTCCTGTGCTACTTCTCTCTGCTAG
GTTCCTAAAATATTAGTATAAACTTTGATGAGAACAGTACGGATACATGATGGACCTTCATTGTTCACGTGAAGGAAAATATACTCCCTCCGTTCCATAATTCTTGTCGAAATATTACAT
GTATCTAGACACTTTTTAGGAATAGATACATCCATTTTTGGTCAAATTTGAGACAAGAATTATGGAACGAAGGGAGTATTTAGCTAAAACATGTATTAAAAATTATCGCTATTCTTTATT
CCATTTATTCATCTGTTTGATATAAACTTATGAGCTACCACATGCAATGTTTTAGAACTACCTCGTGGAGGTAATCTGCTTCAGGCTGACATGCCTCCTTGAGGATATCACCTGTATATA
GGTGTTCATTTATCTGTAAGGTGCACTTTGGTGCACCCTATTCGAACACTAACAGAACATATTGATGCCATACCAACATCAACCTTGTAAAAAAAATGGACTACAGTGTTACATTTTTTA
TGCATGTTAGTGCTATAATATATTTTATGGTAGATTTAGTTATCAGCAACCAGCATTACTTACATGGTTATATTTATACTTTGCCACCATTCCAGCTGCTGGTCCGCCTTCACCTGCTGA
ACATTTGCGGGAAGTATTCTACAGAATGGGCCTGAATGACAAG
GTATGCAAAGACTGCTTTATTCCACCTTTTAACTATTCTGTAGGAGTACAAGATAATTCTGCATTTTCTTGTCTCAT
TTGTTTTGTGATGTGTAGGAAATTGTTGCATTGTCAGGAGCACACACACTTGGACGGTCAAGACCAGAGCGCAGTGGCTGGGGTAAACCAGAAACAAAATACACTGTACGTAAATTACTG
CTGTAGCTCATTGTTCTCATTTTTTTCTTTGGACATGCTCATTGTTCTCATTCAAAAGATGCCTTATTTATTAAAACATTTGTCAGAGCACTAGCTGAATGACGCATGCACTGCTAGAGT
AACAGAAGTAATAAATATAAATTATGAATAATCCAACCACGTGGCATGATTGCCATTCAAATCCGACGGTTTCAAAATTAATTTACACTTACTTAGAAATGAAAAGGCTGGAAAATATTT
AGATTTTTTGATAAAAGTTAAGCAGCACTTCATTAGTTCCTTGCATATACACATCCTGCAAAAGCACGCTTACAGATTGCTATTTCGTGCTACGTGCTGCCAATGCATTTATTTTCATTC
GGACAAGAAATTGTCATGTGTTTTCTTTCCATGATTCACAAGAACAAACATAAGACATATTTTATTCGTGTACACCGCTAGTGGCATTTATCAATATTATTGTGTGTCTTCAACAGTGAA
TGAGCTATATGAAAATGAACTATATTCCTGTCACCATCACTAACTTCTCTACTACAGAGCTTATCTTTTTACAAATATGTTCTTGTCGGTAGTACTTAGTACCATTATGTTCTCACTGAA
GAATGTTGTGAATGGTATATCATATTGTTCGCGTAATTGATTGCTGTACTTGACTTGCCAGAAAAACGGGCCTGGTGCAACTGGTGGGCAATCTTGGACATCTCAGTGGCTCAAGTTTGA
CAACAGCTATTTCAAG
GTAAGATGCCTTATTTGCTATATGCTATAGTAATACCTGCAATTATGTTAACAGCTAAATAATACACATAAATTTTTCAGGATGTTAAAGAGCGACGAGATGAG
GACCTTCTAGTTCTGCCTACAGATGCTGTGCTCTTTGAGGACCCATCATTTAAG
GTTAGTGATGATTCTCATATTACAAAATGAACTGCACATATTTAGCTGATTCTCTGAACTGTATTT
CGTGTGTTGCCATGCTTGAAGATTTATGCTGAAAGGTATGCTGAGGATCAGGATACATTTTTTGAAGACTATGCTGAAGCTCATGCTAAATTGAGTAATCTCGGGTCTAAGTTTGATCCT
CCGAAG
GTAAATGAGATTAAAAGAAATGATTCCTTAGAGCTAGGAAAACATGCTATAAGTTCATGCCGACATGCTTACATTGAAATTATGCAGGGTATATCACTGGACTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGGCCGTCCACCACCACCTCCTCCGCCGCGGGCTCGCCGGCGGGTCCCCCCTCAGCCCTCTCCGCGGCCTCTTCCTCGTATCCCAGGAGCTCGGGCGGCGTCAGGCGAGCTCGGCGGCGG
CGGGGGATGCGGCGGCTGAGCTGAGGGGCGCGCGGGAGGACGTCAGGCAGCTGCTTAAGGACAAGCACTGCCACCCCATCCTG
GTTCGGTTGGGTTGGCACGACTCTGGCACTTATGACA
AGAACATTAGCGAGTGGCCAAAGTGTGGTGGAGCGAATGGCAGCCTGAGATTTGAAATCGAGTTAAAGCATGCCGCTAATGCTG
GCCTTGTGAATGCTCTGAAGCTGGTTCAAACCATCA
AGGACAAATATGCCGGTGTCACTTATGCAGATCTGTTTCAGCTTGCCAGTGCTACTGCCATTGAG
GAAGCTGGTGGCCCCAAAATCCCCATGATCTATGGAAGGGTTGATGTTTCTGCCC
CTGAACAGTGCCCACCAGAGGGGAGACTCCCTG
CTGCTGGTCCGCCTTCACCTGCTGAACATTTGCGGGAAGTATTCTACAGAATGGGCCTGAATGACAAGGAAATTGTTGCATTGTCAG
GAGCACACACACTTGGACGGTCAAGACCAGAGCGCAGTGGCTGGGGTAAACCAGAAACAAAATACACT
AAAAACGGGCCTGGTGCAACTGGTGGGCAATCTTGGACATCTCAGTGGCTCA
AGTTTGACAACAGCTATTTCAAG
GATGTTAAAGAGCGACGAGATGAGGACCTTCTAGTTCTGCCTACAGATGCTGTGCTCTTTGAGGACCCATCATTTAAGATTTATGCTGAAAGGTATG
CTGAGGATCAGGATACATTTTTTGAAGACTATGCTGAAGCTCATGCTAAATTGAGTAATCTCGGGTCTAAGTTTGATCCTCCGAAG
GGTATATCACTGGACTAG

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
CAAACACGCG GACCAACGAA CTACCCCAAA ACCCTTCTTC CTTCTCCCCC CGCCGCCGGC GCCGACATGG CCGTCCACCA CCACCTCCTC CGCCGCGGGC TCGCCGGCGG GTCCCCCCTC  AGCCCTCTCC GCGGCCTCTT CCTCGTATCC CAGGAGCTCG GGCGGCGTCA GGCGAGCTCG GCGGCGGCGG GGGATGCGGC GGCTGAGCTG AGGGGCGCGC GGGAGGACGT CAGGCAGCTG  CTTAAGGACA AGCACTGCCA CCCCATCCTG GTTCGGTTGG GTTGGCACGA CTCTGGCACT TATGACAAGA ACATTAGCGA GTGGCCAAAG TGTGGTGGAG CGAATGGCAG CCTGAGATTT  GAAATCGAGT TAAAGCATGC CGCTAATGCT GGCCTTGTGA ATGCTCTGAA GCTGGTTCAA ACCATCAAGG ACAAATATGC CGGTGTCACT TATGCAGATC TGTTTCAGCT TGCCAGTGCT  ACTGCCATTG AGGAAGCTGG TGGCCCCAAA ATCCCCATGA TCTATGGAAG GGTTGATGTT TCTGCCCCTG AACAGTGCCC ACCAGAGGGG AGACTCCCTG CTGCTGGTCC GCCTTCACCT  GCTGAACATT TGCGGGAAGT ATTCTACAGA ATGGGCCTGA ATGACAAGGA AATTGTTGCA TTGTCAGGAG CACACACACT TGGACGGTCA AGACCAGAGC GCAGTGGCTG GGGTAAACCA  GAAACAAAAT ACACTAAAAA CGGGCCTGGT GCAACTGGTG GGCAATCTTG GACATCTCAG TGGCTCAAGT TTGACAACAG CTATTTCAAG GATGTTAAAG AGCGACGAGA TGAGGACCTT  CTAGTTCTGC CTACAGATGC TGTGCTCTTT GAGGACCCAT CATTTAAGAT TTATGCTGAA AGGTATGCTG AGGATCAGGA TACATTTTTT GAAGACTATG CTGAAGCTCA TGCTAAATTG  AGTAATCTCG GGTCTAAGTT TGATCCTCCG AAGGGTATAT CACTGGACTA GCTGACATCA ACTACTGATG AACTGCATTT CTTGCAATAA ATTTTGAAGC ATATGGTCAT GGAGCTTGGT  TCTGGTTTTA TGACCGCTCC AACATATTGG ATCAACGAGA GCAGTATTTT GAGCTGTGTG CACCACTACG AGAAATAAAA GCAGCATTGA ACAATTCCAG CACCAAAGAT TTGTTACATT 
TAAGATACTT GTTGTACGGT ACTGTATCGA GATCCTACAT GGTGGTGATA AAAAAAAAAT CAAGCAGTTG GTCTTTCACT C 

Retrieve as FASTA