Entry information : BdiPrx20 (Bradi1g32870)
Entry ID 7907
Creation 2011-01-17 (Toky Ramarohetra)
Last sequence changes 2011-01-17 (Toky Ramarohetra)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2013-12-22 (Christophe Dunand)
Peroxidase information: BdiPrx20 (Bradi1g32870)
Name (synonym) BdiPrx20 (Bradi1g32870)
Class Class III peroxidase    [Orthogroup: Prx010]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Brachypodium
Organism Brachypodium distachyon    [TaxId: 15368 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value BdiPrx20
start..stop
S start..stop
OsPrx89 516 0 32..337 30..333
SiPrx29 493 2e-177 31..337 24..328
SofPrx01 491 2e-176 28..337 23..329
SbPrx139 482 4e-173 31..337 26..329
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 28373164..28373394 231 N° 2 28373499..28373859 361 N° 3 28375072..28375496 425  
join(28373164..28373394,28373499..28373859,28375072..28375496)


exon

Literature and cross-references BdiPrx20 (Bradi1g32870)
DNA ref. Phytozome 12:   Bd1 (28373164..28375496)
Protein sequence: BdiPrx20 (Bradi1g32870)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   338 (315)
PWM (Da):   %s   35946.51 (33793.3) Transmb domain:   %s   i7-24o
PI (pH):   %s   9.31 (9.11) Peptide Signal:   %s   cut: 24 range:24-338
Sequence 379
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAARSAMLTLLLSAILAVGGAAAAKAESSGKLRQGFYSHSCPRAEQLVARYARRHVPRSPSLAATLLRTHFHDCFVRGCDASVLLNGRKKNNGEAEKEAAPNLTLRGFAFLDGAKALVEEECPGVVSCADVLALAARDAVAAIGGPFWKVPTGRRDGRVSRKQEALDQIPAPTMNFTALLASFRSKGLELPDLVWLSGAHTIGIAHCDSFGERLYNFTGRGGAGDADPSLDTAYAATLRRTKCATPTDNTTIVEMDPGSFLTFDLGYYRGLLKRRGLFQSDAALITDAAARADVESVAKGPPEVFFQVFARSMVRLGMVGVKTGAQGEIRRHCAVVNG

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 1, 2 introns), no ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGGCGGCACGATCTGCGATGCTGACGCTCCTGTTATCCGCAATTTTGGCCGTCGGCGGCGCTGCAGCGGCGAAGGCGGAGAGTTCAGGCAAGCTGCGGCAGGGGTTCTACTCCCACAGCT
GCCCGCGGGCCGAGCAGCTCGTGGCGCGCTACGCCCGCCGCCACGTCCCCCGCTCCCCTTCCCTCGCTGCCACCCTCCTCCGCACCCACTTCCACGACTGCTTCGTTAGG
GTAAGCAAAG
AAAGCAAACATCTTCCATGGCTCCGGCCATGACGATCGCCATGAATTCCCACAATGCAATGCTAAACCCGGCTCTGTTTACTCTGTTTTTTCAGGGGTGCGACGCGTCGGTGCTGCTGAA
CGGGAGGAAGAAGAATAATGGGGAAGCGGAGAAGGAGGCGGCGCCGAACCTGACGCTGCGCGGGTTCGCGTTCCTGGACGGGGCCAAGGCGCTGGTGGAGGAGGAGTGCCCGGGGGTCGT
GTCCTGCGCCGACGTGCTGGCACTCGCCGCGCGCGACGCCGTGGCCGCCATCGGTGGGCCGTTCTGGAAGGTGCCGACGGGGAGGAGGGACGGGAGGGTGTCGCGGAAGCAGGAGGCGCT
CGACCAGATCCCGGCCCCCACCATGAACTTCACCGCGCTCCTCGCGTCGTTCCGGAGCAAAGGGCTCGAGCTCCCCGACCTCGTCTGGCTGTCAG
GTGACACAACAAAATTAACAGTTTT
TCACAACGCAAGAGTAGTGATTAGTACCAAATACCGATGCGAAGAGTAAGTTGATTAGTTAGTTAGTGTACGTGGCAGAAATGCAGCCTCAAATCGTTGTTTTTTCCTTGTCGAGTTCAT
TGGCACCGACACTCAGTTGAGTGAGTGAGACCACTAGATGACTAGATAGCTCTCGTGAGCTGCTCCTTTTTTTTTTCTGTCGAGCTAGCGGCAACTAAGCCGGCAGCTACCACGCGATCC
TACTACTACCCACTCCACTCAGAGTCACATGACTATATACTCTGTATTGCTCTGTTGCTGAAATGATGGCTCCGAGATAAAAAGAGGTATGACAGAGAAGAAAAGGGAGCTTAAAGCTTG
CCATGCGTGTGTCAAACAAAGGTCTCGGTAGAATTCTAGAACTGAATGCACGCGGACGTTCTCCCTCCACTCTCTAGAAATCCAGAACAGTTACTCCAACCAACAAGGAGGCTTTTTAAT
TGGACAATCATGAGTCTGTTCAGTGTTCACTTCAATGCCATCGTAGCACAGAGGCACCGCTGCACAGATTTTATGTTCTGCTCTTTGGAAAAAATAGTATCACCGCATAGATGTAGATAC
AGACACGCTAACCAGTGTCTTTAACTTGTCGAATAACCGCAACAAAATGGGTCCAAAAAGAGCAGGGAGTTAACGACAGACAAACTAATTAAGGGCGGAAGTACAGAGTATATATGAACT
GTCAAGGACTTCTTGAACTGCTTGTCAAGTTCTCGATCCTACCAGCTTAGGTCACGAGAGATTCACATGTTTTAATATGAGTACAGGGCAATCAGTTGTGATGTAGACCTGCATGCTACT
GCTGTCTGCTAACCACACTGGTCTATTAATTCCTACCTGTTTAGATTGATGGTACCAGAAAAAAAGACACAAATGTCATGCATACTCTGAAGCAGGATAATGTTAGTATGTTGCTCCACA
ATCTAAGCCTCCTTGCTAATGGGGCAATTCTACACGTACACCATTGCATAGTAGTATTACTGAACTTACTGCATTTACATGGTTCAGATTTCAGCAACCAACCGCTGACTCGCACAATCG
CAGATCAGAAGCGCTGAAAATACATTTGAACTACTGAACTGGAATGTTTTACTGAACTTTCTGAATTTTGCATCTGTGACCTGGCAACCTGATCATCAACTCACCAGGCGCGCACACGAT
CGGCATCGCGCACTGCGACTCCTTCGGCGAGCGGCTCTACAACTTCACGGGCCGCGGCGGCGCCGGCGACGCGGACCCGTCGCTGGACACCGCCTACGCCGCGACCCTCCGCCGCACAAA
GTGCGCGACGCCGACGGACAACACGACGATCGTGGAGATGGACCCGGGAAGCTTCCTGACCTTCGACCTGGGCTACTACCGGGGCCTCCTCAAGCGCCGGGGCCTGTTCCAGTCGGACGC
GGCCCTGATCACGGACGCCGCGGCAAGGGCCGACGTCGAGAGCGTGGCCAAAGGGCCCCCCGAGGTGTTCTTCCAGGTGTTCGCGAGGTCCATGGTGAGGCTGGGCATGGTGGGCGTCAA
GACCGGCGCCCAGGGGGAGATCCGGCGCCACTGCGCCGTCGTCAACGGCTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGGCGGCACGATCTGCGATGCTGACGCTCCTGTTATCCGCAATTTTGGCCGTCGGCGGCGCTGCAGCGGCGAAGGCGGAGAGTTCAGGCAAGCTGCGGCAGGGGTTCTACTCCCACAGCT
GCCCGCGGGCCGAGCAGCTCGTGGCGCGCTACGCCCGCCGCCACGTCCCCCGCTCCCCTTCCCTCGCTGCCACCCTCCTCCGCACCCACTTCCACGACTGCTTCGTTAGG
GGGTGCGACG
CGTCGGTGCTGCTGAACGGGAGGAAGAAGAATAATGGGGAAGCGGAGAAGGAGGCGGCGCCGAACCTGACGCTGCGCGGGTTCGCGTTCCTGGACGGGGCCAAGGCGCTGGTGGAGGAGG
AGTGCCCGGGGGTCGTGTCCTGCGCCGACGTGCTGGCACTCGCCGCGCGCGACGCCGTGGCCGCCATCGGTGGGCCGTTCTGGAAGGTGCCGACGGGGAGGAGGGACGGGAGGGTGTCGC
GGAAGCAGGAGGCGCTCGACCAGATCCCGGCCCCCACCATGAACTTCACCGCGCTCCTCGCGTCGTTCCGGAGCAAAGGGCTCGAGCTCCCCGACCTCGTCTGGCTGTCAG
GCGCGCACA
CGATCGGCATCGCGCACTGCGACTCCTTCGGCGAGCGGCTCTACAACTTCACGGGCCGCGGCGGCGCCGGCGACGCGGACCCGTCGCTGGACACCGCCTACGCCGCGACCCTCCGCCGCA
CAAAGTGCGCGACGCCGACGGACAACACGACGATCGTGGAGATGGACCCGGGAAGCTTCCTGACCTTCGACCTGGGCTACTACCGGGGCCTCCTCAAGCGCCGGGGCCTGTTCCAGTCGG
ACGCGGCCCTGATCACGGACGCCGCGGCAAGGGCCGACGTCGAGAGCGTGGCCAAAGGGCCCCCCGAGGTGTTCTTCCAGGTGTTCGCGAGGTCCATGGTGAGGCTGGGCATGGTGGGCG
TCAAGACCGGCGCCCAGGGGGAGATCCGGCGCCACTGCGCCGTCGTCAACGGCTAG

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGGCAC GATCTGCGAT GCTGACGCTC CTGTTATCCG CAATTTTGGC CGTCGGCGGC GCTGCAGCGG CGAAGGCGGA GAGTTCAGGC AAGCTGCGGC AGGGGTTCTA CTCCCACAGC  TGCCCGCGGG CCGAGCAGCT CGTGGCGCGC TACGCCCGCC GCCACGTCCC CCGCTCCCCT TCCCTCGCTG CCACCCTCCT CCGCACCCAC TTCCACGACT GCTTCGTTAG GGGGTGCGAC  GCGTCGGTGC TGCTGAACGG GAGGAAGAAG AATAATGGGG AAGCGGAGAA GGAGGCGGCG CCGAACCTGA CGCTGCGCGG GTTCGCGTTC CTGGACGGGG CCAAGGCGCT GGTGGAGGAG  GAGTGCCCGG GGGTCGTGTC CTGCGCCGAC GTGCTGGCAC TCGCCGCGCG CGACGCCGTG GCCGCCATCG GTGGGCCGTT CTGGAAGGTG CCGACGGGGA GGAGGGACGG GAGGGTGTCG  CGGAAGCAGG AGGCGCTCGA CCAGATCCCG GCCCCCACCA TGAACTTCAC CGCGCTCCTC GCGTCGTTCC GGAGCAAAGG GCTCGAGCTC CCCGACCTCG TCTGGCTGTC AGGCGCGCAC  ACGATCGGCA TCGCGCACTG CGACTCCTTC GGCGAGCGGC TCTACAACTT CACGGGCCGC GGCGGCGCCG GCGACGCGGA CCCGTCGCTG GACACCGCCT ACGCCGCGAC CCTCCGCCGC  ACAAAGTGCG CGACGCCGAC GGACAACACG ACGATCGTGG AGATGGACCC GGGAAGCTTC CTGACCTTCG ACCTGGGCTA CTACCGGGGC CTCCTCAAGC GCCGGGGCCT GTTCCAGTCG  GACGCGGCCC TGATCACGGA CGCCGCGGCA AGGGCCGACG TCGAGAGCGT GGCCAAAGGG CCCCCCGAGG TGTTCTTCCA GGTGTTCGCG AGGTCCATGG TGAGGCTGGG CATGGTGGGC  GTCAAGACCG GCGCCCAGGG GGAGATCCGG CGCCACTGCG CCGTCGTCAA CGGCTAGTCT GTAAACTCTG TATATATATG TATGTATGGC CACGATGATC CGTGGGTTTT TGTGGGTGGT 
TTTATGTTTC TATTGGTCCA ACTGTAACTA GGAAAATGGT GCAATAAACT T 

Retrieve as FASTA