Entry information : BdiPrx94(Bradi2g52077)
Entry ID 7914
Creation 2011-01-17 (Toky Ramarohetra)
Last sequence changes 2011-03-14 (Toky Ramarohetra)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2023-01-18 (Christophe Dunand)
Peroxidase information: BdiPrx94(Bradi2g52077)
Name BdiPrx94(Bradi2g52077)
Class Class III peroxidase    [Orthogroup: Prx175]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Brachypodium
Organism Brachypodium distachyon    [TaxId: 15368 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value BdiPrx94
start..stop
S start..stop
TaPrx167-1B 578 0 1..334 1..334
TaPrx167-1D 559 0 14..335 13..335
TaPrx167-1A 551 0 14..335 13..335
OsPrx19 486 1e-174 1..335 1..336
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 51588081..51588311 231 N° 2 51587758..51587946 189 N° 3 51587062..51587649 588  
complement(join(51587062..51587649,51587758..51587946,51588081..51588311))


exon

Literature and cross-references BdiPrx94(Bradi2g52077)
DNA ref. Phytozome 12:   Bd2 (51588311..51587062)
Protein sequence: BdiPrx94(Bradi2g52077)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   335 (309)
PWM (Da):   %s   36549.07 (33880.4)  
PI (pH):   %s   5 (4.81) Peptide Signal:   %s   cut: 27 range:27-335
Sequence 473
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MALDVVLVRLLIIAAVASVLPARGRADGAAGLAIGFYNEKCPGAEDLVLEEMRDIVHEDRTLGPALLRLLFHDCFVRGCDASIMLKSRSKKGERDAKPMSYSLRGFDEVERIKAKLEEACPLTVSCADIIIMAARDAVYLNNGPRFPVETGRRDGKVSNCVDAENDLAPPNANIVDLKTYFSVKNLSWKDLVVLSGSHTIGSSQCAAFAGDRLYNHSGKGMQDPTLNKTYAPDLRMMCEAGNETDTTPVSMDPGSPHEFDLSYYRDVYSNKGLFVSDQALLDDKLTHDYVARMAAAPSPDEFFDDYAAAMINMGRMEVLTGHNGEIRKICGAYVD*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 2, introns 1 and 2), no EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCATTGGACGTCGTCCTCGTCAGGTTACTCATCATTGCGGCCGTGGCGAGCGTTCTGCCGGCGCGGGGCCGCGCGGATGGCGCCGCCGGGCTCGCGATCGGGTTCTACAACGAGAAG
TGCCCGGGCGCGGAAGATCTGGTGCTGGAAGAGATGCGTGACATCGTCCATGAAGACAGGACCCTCGGGCCGGCGCTGCTGCGGCTTCTCTTCCACGACTGCTTCGTCAGG
GTACGTGTT
GGCTGCGTTGCGTGCGGCGTCTTCCCATGTCGCGTCGCGTGCACGAGCCGCGTGGTTGGCGAGGCTTATTAATTCGATCGTGTTAGCTTTGCTTAAAGTGGATGATTAATCTGCGTGATG
TGCAGGGGTGCGACGCGTCGATCATGCTGAAATCGAGGAGCAAGAAGGGGGAGAGGGACGCCAAGCCGATGAGCTACAGCCTCCGCGGCTTCGACGAGGTGGAGCGGATCAAGGCCAAGC
TGGAGGAGGCGTGCCCGCTGACCGTGTCGTGCGCGGACATCATCATCATGGCGGCGCGGGACGCCGTGTACCTG
GTAAATTCATTCAGCTAGCACACACCCACAATCCTCCCTTCCATCA
GCGAGCTCGCGCCATGGATGTCATCTCATCAAACGGCTTCAAATTCGATCCTTCTTCTCCAGAACAACGGGCCACGGTTCCCGGTGGAGACGGGACGCCGGGACGGCAAGGTGTCCAACT
GCGTGGACGCCGAGAACGACCTGGCGCCCCCGAATGCCAACATTGTCGATCTTAAAACCTACTTCAGCGTCAAGAACCTGTCCTGGAAGGACCTGGTGGTGCTGTCAGGGAGCCACACGA
TCGGTTCCTCCCAGTGCGCCGCGTTCGCGGGGGACCGGCTGTACAACCACAGCGGCAAAGGGATGCAGGACCCGACCCTGAACAAGACCTACGCCCCGGACCTGCGGATGATGTGCGAGG
CCGGGAACGAGACGGACACGACGCCGGTGAGCATGGACCCCGGGAGCCCCCACGAGTTCGACCTGAGCTACTACAGGGACGTGTACAGCAACAAGGGCCTCTTCGTCTCCGACCAGGCGC
TCCTCGACGACAAGCTCACGCACGACTACGTGGCAAGGATGGCCGCCGCGCCGTCGCCCGACGAGTTCTTCGACGACTACGCGGCAGCCATGATCAACATGGGGAGGATGGAGGTGCTCA
CGGGCCACAACGGGGAGATCAGGAAAATCTGCGGCGCCTACGTTGACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCATTGGACGTCGTCCTCGTCAGGTTACTCATCATTGCGGCCGTGGCGAGCGTTCTGCCGGCGCGGGGCCGCGCGGATGGCGCCGCCGGGCTCGCGATCGGGTTCTACAACGAGAAG
TGCCCGGGCGCGGAAGATCTGGTGCTGGAAGAGATGCGTGACATCGTCCATGAAGACAGGACCCTCGGGCCGGCGCTGCTGCGGCTTCTCTTCCACGACTGCTTCGTCAGG
GGGTGCGAC
GCGTCGATCATGCTGAAATCGAGGAGCAAGAAGGGGGAGAGGGACGCCAAGCCGATGAGCTACAGCCTCCGCGGCTTCGACGAGGTGGAGCGGATCAAGGCCAAGCTGGAGGAGGCGTGC
CCGCTGACCGTGTCGTGCGCGGACATCATCATCATGGCGGCGCGGGACGCCGTGTACCTG
AACAACGGGCCACGGTTCCCGGTGGAGACGGGACGCCGGGACGGCAAGGTGTCCAACTGC
GTGGACGCCGAGAACGACCTGGCGCCCCCGAATGCCAACATTGTCGATCTTAAAACCTACTTCAGCGTCAAGAACCTGTCCTGGAAGGACCTGGTGGTGCTGTCAGGGAGCCACACGATC
GGTTCCTCCCAGTGCGCCGCGTTCGCGGGGGACCGGCTGTACAACCACAGCGGCAAAGGGATGCAGGACCCGACCCTGAACAAGACCTACGCCCCGGACCTGCGGATGATGTGCGAGGCC
GGGAACGAGACGGACACGACGCCGGTGAGCATGGACCCCGGGAGCCCCCACGAGTTCGACCTGAGCTACTACAGGGACGTGTACAGCAACAAGGGCCTCTTCGTCTCCGACCAGGCGCTC
CTCGACGACAAGCTCACGCACGACTACGTGGCAAGGATGGCCGCCGCGCCGTCGCCCGACGAGTTCTTCGACGACTACGCGGCAGCCATGATCAACATGGGGAGGATGGAGGTGCTCACG
GGCCACAACGGGGAGATCAGGAAAATCTGCGGCGCCTACGTTGACTAA

Retrieve as FASTA