Entry information : BdiPrx99 (Bradi3g09120)
Entry ID 7917
Creation 2011-01-17 (Toky Ramarohetra)
Last sequence changes 2011-01-17 (Toky Ramarohetra)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2014-01-08 (Qiang Li)
Peroxidase information: BdiPrx99 (Bradi3g09120)
Name (synonym) BdiPrx99 (Bradi3g09120)
Class Class III peroxidase    [Orthogroup: Prx102]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Brachypodium
Organism Brachypodium distachyon    [TaxId: 15368 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value BdiPrx99
start..stop
S start..stop
HvPrx13 550 0 2..319 6..322
SiPrx77 537 0 6..319 7..320
HvPrx15 533 0 4..319 7..322
TmPrx06 530 0 2..319 6..322
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 7215738..7215944 207 N° 2 7216082..7216273 192 N° 3 7216404..7216964 561  
join(7215738..7215944,7216082..7216273,7216404..7216964)


exon

Literature and cross-references BdiPrx99 (Bradi3g09120)
DNA ref. Phytozome 12:   Bd3 (7215738..7216964)
EST ref. GenBank:   DV477851.1 [5' end]
Protein sequence: BdiPrx99 (Bradi3g09120)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   319 (297)
PWM (Da):   %s   34246.34 (31791.1) Transmb domain:   %s   i7-29o
PI (pH):   %s   8.26 (8.21) Peptide Signal:   %s   cut: 23 range:23-319
Sequence 360
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MACRSTWHCLLALFLLFSAAYGQLSPTFYARSCPTLQLIVRATMIKALLAERRMGASLLRLHFHDCFVQGCDASILLDDVGSFVGEKTAGPNVRSVRGYEVIDEIKANVELLCPGVVSCADIVALAARDGTLLLGGPTWQVPLGRRDSTTASFAEANSDLPAPTSSLNALIAAFAKKNLSARDMTALSGAHTIGFSQCQNFRGHIYNDTNIDPAFATLRKRSCPAAAPNGDGNLAPFDVQTQLAFDNAYYGNLLVRRGLLHSDQELFNGASQDALVRQYSANPALFNSDFAAAMIQMGKFRPLTGTAGQIRRNCKVVNS

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 3, no intron), 1 EST. Cultivar="Bd21".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGGCTTGCAGGAGTACGTGGCATTGTTTGCTCGCCCTCTTCCTCCTCTTCTCCGCCGCGTATGGGCAGCTCTCGCCGACGTTCTACGCCAGGAGCTGCCCGACACTGCAGCTCATCGTGC
GCGCCACCATGATCAAGGCGCTCCTCGCCGAGCGCCGCATGGGGGCCTCCCTCCTAAGGCTCCACTTCCATGACTGCTTCGTTCAA
GTAATCATGATTTAATTAACGCTTAGCCGAACAT
CTGTCTGTATTCAGTATAGCCCGCTGTAGAGCCAACCTTACGTAAATACGTGCACTTTAAGCATTGATTGATGTGAAATTTGGTTGATTACGTACATATATAGGGCTGCGACGCATCCAT
TCTTCTGGACGACGTGGGGAGCTTCGTGGGCGAGAAGACTGCCGGCCCTAACGTGAGATCGGTACGCGGCTACGAGGTCATCGACGAGATCAAGGCGAACGTGGAGCTCCTCTGCCCCGG
CGTCGTCTCCTGCGCCGACATCGTCGCCCTCGCCGCAAGGGACGGCACCCTTCTG
GTACGTACAGATATGGACATGGACACGTGCGTGCATAAATTAGATAGAAGCTAGTCATGCATACA
CGCAACTAGCTACCTAGTGTGCATGTGAGGATTAATTAAATTCATCACCGGTCGTTTGCATGCAGCTCGGCGGGCCCACGTGGCAGGTGCCGCTCGGCCGGCGCGACTCAACGACGGCGA
GCTTCGCCGAGGCCAACTCGGACCTCCCGGCGCCGACATCGAGCCTCAACGCTCTCATCGCGGCGTTCGCCAAGAAGAACCTGAGCGCGCGGGACATGACGGCGCTCTCGGGCGCGCACA
CCATCGGCTTCTCGCAGTGCCAGAACTTCCGCGGCCACATCTACAACGACACAAACATCGACCCGGCGTTCGCCACGCTCCGGAAGCGCAGCTGCCCCGCCGCGGCGCCAAACGGCGACG
GCAACCTGGCCCCCTTCGACGTGCAGACGCAGCTCGCCTTCGACAACGCCTACTACGGCAACCTGCTCGTCAGGCGCGGGCTCCTGCACTCGGACCAGGAACTCTTCAACGGCGCCTCCC
AGGACGCGCTCGTCAGGCAGTACAGCGCCAACCCGGCGCTCTTCAACTCCGACTTCGCCGCGGCCATGATACAGATGGGGAAATTCAGGCCGCTCACCGGGACGGCCGGACAGATCAGGC
GCAACTGCAAGGTCGTCAACAGCTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGGCTTGCAGGAGTACGTGGCATTGTTTGCTCGCCCTCTTCCTCCTCTTCTCCGCCGCGTATGGGCAGCTCTCGCCGACGTTCTACGCCAGGAGCTGCCCGACACTGCAGCTCATCGTGC
GCGCCACCATGATCAAGGCGCTCCTCGCCGAGCGCCGCATGGGGGCCTCCCTCCTAAGGCTCCACTTCCATGACTGCTTCGTTCAA
GGCTGCGACGCATCCATTCTTCTGGACGACGTGG
GGAGCTTCGTGGGCGAGAAGACTGCCGGCCCTAACGTGAGATCGGTACGCGGCTACGAGGTCATCGACGAGATCAAGGCGAACGTGGAGCTCCTCTGCCCCGGCGTCGTCTCCTGCGCCG
ACATCGTCGCCCTCGCCGCAAGGGACGGCACCCTTCTG
CTCGGCGGGCCCACGTGGCAGGTGCCGCTCGGCCGGCGCGACTCAACGACGGCGAGCTTCGCCGAGGCCAACTCGGACCTCC
CGGCGCCGACATCGAGCCTCAACGCTCTCATCGCGGCGTTCGCCAAGAAGAACCTGAGCGCGCGGGACATGACGGCGCTCTCGGGCGCGCACACCATCGGCTTCTCGCAGTGCCAGAACT
TCCGCGGCCACATCTACAACGACACAAACATCGACCCGGCGTTCGCCACGCTCCGGAAGCGCAGCTGCCCCGCCGCGGCGCCAAACGGCGACGGCAACCTGGCCCCCTTCGACGTGCAGA
CGCAGCTCGCCTTCGACAACGCCTACTACGGCAACCTGCTCGTCAGGCGCGGGCTCCTGCACTCGGACCAGGAACTCTTCAACGGCGCCTCCCAGGACGCGCTCGTCAGGCAGTACAGCG
CCAACCCGGCGCTCTTCAACTCCGACTTCGCCGCGGCCATGATACAGATGGGGAAATTCAGGCCGCTCACCGGGACGGCCGGACAGATCAGGCGCAACTGCAAGGTCGTCAACAGCTGA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
AAGCAAAAGC CACTGATCAG CTAACTATCG CACAGTGCAG TGTGGTGAAG AACACTGAAC ACACACTCAG TTTGCGTAGC TAGATAAAGG TTTGTGAGCT TATTAGCCAT GGCTTGCAGG  AGTACGTGGC ATTGTTTGCT CGCCCTCTTC CTCCTCTTCT CCGCCGCGTA TGGGCAGCTC TCGCCGACGT TCTACGCCAG GAGCTGCCCG ACACTGCAGC TCATCGTGCG CGCCACCATG  ATCAAGGCGC TCCTCGCCGA GCGCCGCATG GGGGCCTCCC TCCTAAGGCT CCACTTCCAT GACTGCTTCG TTCAAGGCTG CGACGCATCC ATTCTTCTGG ACGACGTGGG GAGCTTCGTG  GGCGAGAAGA CTGCCGGCCC TAACGTGAGA TCGGTACGCG GCTACGAGGT CATCGACGAG ATCAAGGCGA ACGTGGAGCT CCTCTGCCCC GGCGTCGTCT CCTGCGCCGA CATCGTCGCC  CTCGCCGCAA GGGACGGCAC CCTTCTGCTC GGCGGGCCCA CGTGGCAGGT GCCGCTCGGC CGGCGCGACT CAACGACGGC GAGCTTCGCC GAGGCCAACT CGGACCTCCC GGCGCCGACA  TCGAGCCTCA ACGCTCTCAT CGCGGCGTTC GCCAAGAAGA ACCTGAGCGC GCGGGACATG ACGGCGCTCT CGGGCGCGCA CACCATCGGC TTCTCGCAGT GCCAGAACTT CCGCGGCCAC  ATCTACAACG ACACAAACAT CGACCCGGCG TTCGCCACGC TCCGGAAGCG CAGCTGCCCC GCCGCGGCGC CAAACGGCGA CGGCAACCTG GCCCCCTTCG ACGTGCAGAC GCAGCTCGCC  TTCGACAACG CCTACTACGG CAACCTGCTC GTCAGGCGCG GGCTCCTGCA CTCGGACCAG GAACTCTTCA ACGGCGCCTC CCAGGACGCG CTCGTCAGGC AGTACAGCGC CAACCCGGCG  CTCTTCAACT CCGACTTCGC CGCGGCCATG ATACAGATGG GGAAATTCAG GCCGCTCACC GGGACGGCCG GACAGATCAG GCGCAACTGC AAGGTCGTCA ACAGCTGATC AATCGTCGTC  GTCTCATTAT AAACTTCACA GTGCTAAGTG TGCAACGTGA GCATGCGTAC AAGTAAGTAC GATATGTGGT GATGGACATG CATGTGTATA GTTTGGTTGG CTACAAAGGA ACCCAACCAT  GCAAGCAGCT TGCATGCGTG GATGGAAAAA ATAAGAGATG TACGGTTGGT TCAAATAATT CCTGGGGTTC AAAAGTGAGT AACCCTGCTT CCAGGTTGTA AGATACCTTT GTGCCTGATC  ATGTAATTGG CTCTCGCCGT CCTATATTAA GTGACTATAT ATTTCATATA TCTAGATGCC TTTTAGTTAT AGATACATGC ATATTTAGAC AAATTTGAGT AACTTAATAT GGGACGGAGG 
GAGTATAAGG AAACAA 

Retrieve as FASTA