Entry information : BdiPrx66(Bradi2g12216)
Entry ID 7948
Creation 2011-01-27 (Toky Ramarohetra)
Last sequence changes 2011-02-15 (Christophe Dunand)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2023-01-18 (Christophe Dunand)
Peroxidase information: BdiPrx66(Bradi2g12216)
Name BdiPrx66(Bradi2g12216)
Class Class III peroxidase    [Orthogroup: Prx084]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Brachypodium
Organism Brachypodium distachyon    [TaxId: 15368 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value BdiPrx66
start..stop
S start..stop
BdiPrx65 563 0 25..355 24..356
TmPrx08 547 0 1..353 1..354
TaPrx39 545 0 8..354 9..357
TaPrx46 543 0 1..353 1..354
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 10570312..10570542 231 N° 2 10571976..10572812 837  
join(10570312..10570542,10571976..10572812)


exon

Literature and cross-references BdiPrx66(Bradi2g12216)
DNA ref. Phytozome 12:   Bd2 (10570381..10572812)
Protein sequence: BdiPrx66(Bradi2g12216)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   355 (325)
PWM (Da):   %s   37666.95 (34520.2)  
PI (pH):   %s   5.66 (4.94) Peptide Signal:   %s   cut: 31 range:31-355
Sequence 396
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASRSRQLAGLAMLLLPAVLCLQMPAPSRAQLQVGFYNTTCPNAEALVRQAVTAAFANNSGIAAGLIRLHFHDCFVRGCDASVLLTINPGGGTTEKDSPPNNPSLRGFDVIAAAKALVEQSCPRTVSCADILAFAARDSVNLTGTNSFYQVPSGRRDGNISTQDDAINNLPGPNSTADSLITGFARKNLTAEDMVVLSGSHTLGRSHCDAFLFKNRERLASGTVSPAYQALLEALCPPTSGQFTLVTTEIDLSTPVVLDNNYYRLLPLNLGLHFSDDQLVRNGTLNAFVNQFIADETLWKQKFFAAMIKMGNIEPKTGAQGEVRLNCSLVNPASSSSAGVIEMPLPDNDGEVATS

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 2, intron 1).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGGCGAGCCGCAGCAGGCAGCTGGCTGGCCTAGCGATGCTGCTGCTGCCGGCCGTGCTGTGCCTGCAGATGCCGGCGCCGAGCCGCGCGCAGCTGCAGGTGGGGTTCTACAACACCACCT
GCCCCAACGCCGAGGCGCTCGTCCGGCAGGCCGTCACGGCGGCCTTCGCTAACAACTCCGGCATCGCCGCCGGACTCATCCGCCTCCACTTCCATGACTGCTTCGTCAGG
GTAAGCGCGC
GCAGGCTAATTAATTAAAGCAGCTTCTAGCCCACATAGTTTTGCTTGTTTTAGTACTAGCATATTTACAGGTTATTTGTCCTTTAAAGTCAAACAGACACAAAAACTTTTGTCATGCAGC
AAAACATTTTAATTATGAGTGTCAAATCCATACGGTTATTAAAAAGTTTCCAAGGCATAGCTTTAAATGCATGTGTTCTCGCGATTAACTTCGTCAAGTAATTTAGTTACAAATAGCTGG
GTTAATCTAACTAACCAAGCCGAATCCCTCGTTAAAAAGAGTCCAATAATTAATATGGATCTTCAGCACCGATATTATACTTGTTCAAGAATACATGCTTGGCGCTTTTGAAAACTGAAA
AGGTGAACTCTTATGACCAGCTTACAGTAACAAAAATTAATCCCACAAGTAGAAATGTTACATTTTGAAGAAAAAATCAAATATAACTACAGACACGTGAAGGTAATACACAATTAAATA
TTTCCACATGATAGGGGAAATATGTATTTATAGATAATTTAACTAAGAAGATAAAAACATCAGTTTTTTTTTTTTGGAAGGATAACGATTTTGAATTGACCAACAAGCTTAAAACGATGG
GGATTGGTGATCGACCGAGGATGTGGCCAGCCGGTGTACTCGTTACAGTAAAAAAAGCCACTATTCAACACACTCTTGTTTGGACCACCTATCAAATCAGGCTATAGCTAGCTTCCCATC
ACACATGACGTGTTACCTTGTTAGTTAGGCAGTTCGCTGCTTTATGTAGACTTCTCAATGAGTTAGACAAACAACAGTCAAATGTTTATAGTAGTACTTGTTTGAAGAGCAGGTATAGGC
GTATAGGTGCTAACTGAAGTATAAGTACTGCTACTACATGTCTACGACATGCGACTACCGACGTGAGTATTAGTGTCGCAGCCGACGTTGTATGCAACGACTAGTCGACCATGATACACC
TACCATGTTGTCATGACGTACGCAGTAAAGAAATGTCCAATTTAATTTGTCCATGTCCATCCAGCACCTTCCAGGGTAGTTGATAGGGCGGCTAATTTGAAGAAGAAATTAATAGTTTTT
GAACGACCGGGCCACATTAGGTAGCTAGGTTAATATAATAACGAGACGTACGTATGGGTCGAGCGATTAAAGGACATATATTTATGGCTATATCCAAGTTGCCTGCTTAAATCTAAGTTG
ACGGATTAGAGCCGTTGCATTAATATTTAGATCTCATTTTACTTTTCTTTTTATCGTTTGTTTCGAACGTTAAATCACAAATCATATCCACGATGAGAAATCAACTTATGTCTAACTAAA
AATTAGACAATTTAGATATAGGAAAACCGTAATCTTATCATGGTGTGCCGATCTGCATGTGTACGCGGTGAATTGAGACGCTACTTGATTTATGTACATCCAGGGCTGCGATGCCTCGGT
GCTTCTGACCATCAACCCGGGCGGCGGCACGACGGAGAAGGACTCCCCGCCCAACAACCCGAGCCTCCGCGGCTTCGACGTCATCGCCGCCGCCAAGGCCCTGGTGGAGCAGAGCTGCCC
GCGCACGGTCTCCTGCGCCGACATCCTGGCCTTCGCGGCTCGTGACAGCGTCAACCTCACGGGCACCAACTCGTTCTACCAGGTCCCCTCCGGCCGCCGCGACGGGAACATCTCGACACA
GGACGACGCCATAAACAACCTCCCGGGCCCCAACTCGACGGCCGACTCCCTCATCACGGGCTTCGCCAGAAAGAACCTGACCGCCGAGGACATGGTGGTGCTCTCGGGGTCCCACACGCT
GGGCCGCTCCCACTGCGACGCGTTCCTGTTCAAGAACCGCGAGAGGCTGGCGAGCGGCACCGTCAGCCCGGCGTACCAGGCGCTGCTGGAGGCGCTGTGCCCGCCCACCAGTGGCCAGTT
CACGCTGGTCACCACGGAGATCGACCTCAGCACGCCCGTCGTGCTGGACAACAACTACTACAGGCTGCTCCCGCTCAACCTGGGCCTCCACTTCTCTGATGACCAGCTCGTCCGCAACGG
CACGCTCAATGCCTTTGTCAACCAGTTCATCGCCGACGAGACGCTGTGGAAGCAGAAGTTCTTTGCGGCCATGATCAAGATGGGCAACATCGAGCCCAAGACCGGGGCGCAGGGCGAGGT
GCGGCTCAACTGCAGCCTCGTCAACCCGGCCTCGTCTTCCTCCGCCGGGGTGATCGAGATGCCCCTCCCGGACAACGACGGTGAGGTTGCCACCAGCTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGGCGAGCCGCAGCAGGCAGCTGGCTGGCCTAGCGATGCTGCTGCTGCCGGCCGTGCTGTGCCTGCAGATGCCGGCGCCGAGCCGCGCGCAGCTGCAGGTGGGGTTCTACAACACCACCT
GCCCCAACGCCGAGGCGCTCGTCCGGCAGGCCGTCACGGCGGCCTTCGCTAACAACTCCGGCATCGCCGCCGGACTCATCCGCCTCCACTTCCATGACTGCTTCGTCAGG
GGCTGCGATG
CCTCGGTGCTTCTGACCATCAACCCGGGCGGCGGCACGACGGAGAAGGACTCCCCGCCCAACAACCCGAGCCTCCGCGGCTTCGACGTCATCGCCGCCGCCAAGGCCCTGGTGGAGCAGA
GCTGCCCGCGCACGGTCTCCTGCGCCGACATCCTGGCCTTCGCGGCTCGTGACAGCGTCAACCTCACGGGCACCAACTCGTTCTACCAGGTCCCCTCCGGCCGCCGCGACGGGAACATCT
CGACACAGGACGACGCCATAAACAACCTCCCGGGCCCCAACTCGACGGCCGACTCCCTCATCACGGGCTTCGCCAGAAAGAACCTGACCGCCGAGGACATGGTGGTGCTCTCGGGGTCCC
ACACGCTGGGCCGCTCCCACTGCGACGCGTTCCTGTTCAAGAACCGCGAGAGGCTGGCGAGCGGCACCGTCAGCCCGGCGTACCAGGCGCTGCTGGAGGCGCTGTGCCCGCCCACCAGTG
GCCAGTTCACGCTGGTCACCACGGAGATCGACCTCAGCACGCCCGTCGTGCTGGACAACAACTACTACAGGCTGCTCCCGCTCAACCTGGGCCTCCACTTCTCTGATGACCAGCTCGTCC
GCAACGGCACGCTCAATGCCTTTGTCAACCAGTTCATCGCCGACGAGACGCTGTGGAAGCAGAAGTTCTTTGCGGCCATGATCAAGATGGGCAACATCGAGCCCAAGACCGGGGCGCAGG
GCGAGGTGCGGCTCAACTGCAGCCTCGTCAACCCGGCCTCGTCTTCCTCCGCCGGGGTGATCGAGATGCCCCTCCCGGACAACGACGGTGAGGTTGCCACCAGCTGA

Retrieve as FASTA