Entry information : SmPrx[P]55b_1
Entry ID 7966
Creation 2011-02-02 (Toky Ramarohetra)
Last sequence changes 2011-02-23 (Christophe Dunand)
Sequence status theoretical translation / pseudogene
Reviewer Not yet reviewed
Last annotation changes 2011-02-23 (Christophe Dunand)
Peroxidase information: SmPrx[P]55b_1
Name SmPrx[P]55b_1
Class Class III peroxidase     [Orthogroup: Prx006]*
Taxonomy Eukaryota Viridiplantae Streptophyta Isoetopsida Selaginellaceae Selaginella
Organism Selaginella moellendorffii    [TaxId: 88036 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SmPrx[P]55b_1
start..stop
S start..stop
SmPrx[P]54b_1 467 2e-170 1..229 1..229
SmPrx[P]51b_1 463 4e-169 1..229 1..229
SmPrx[P]52b_1 441 4e-160 1..229 1..225
SmPrx[P]54a_16 439 4e-159 1..229 1..251
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 2639345..2639699 355 N° 2 2639776..2640110 335  
join(2639345..2639699,2639776..2640110)


exon

Literature and cross-references SmPrx[P]55b_1
DNA ref. Phytozome 12:   scaffold_1 (2639345..2640110)
Protein sequence: SmPrx[P]55b_1
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   229
PWM (Da):   %s   24802.78  
PI (pH):   %s   8.38
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
GCDASILLDSKGSIKSERDSDKNFGIRRLDFIDRIKLMLEAACPGVVSCADIIVLVARESIVFTGGPTIPMLTGRRDSTAASNAAADRLLPPATVSVDNFISLFASKGLSLDESVAIIGAHTIGVGHCVNIVNRLYPNQDSKISLLFASRLRVQCPTANPWMLNNITVINNDMTNLVFDNQYFRDLIARFSTNQQLFLNTFSSAFVKLTSSNVLTGQSGQVRKYCHSVN

Retrieve as FASTA  
Remarks Pseudogene (first exon is missing).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
GGTTGCGACGCGTCCATCTTGCTCGACTCGAAAGGTTCCATCAAAAGCGAAAGAGACTCGGACAAGAACTTTGGCATCCGCCGCTTGGATTTCATCGACAGGATCAAGTTGATGCTGGAG
GCCGCCTGTCCGGGAGTCGTCTCGTGCGCGGACATCATCGTTCTGGTGGCCAGAGAATCCATCGTCTTCACCGGAGGCCCGACAATCCCCATGCTCACAGGAAGAAGAGACAGCACAGCC
GCTTCCAACGCCGCAGCCGACAGGCTGTTGCCTCCAGCAACCGTAAGCGTCGACAACTTCATCAGCCTCTTCGCATCCAAGGGCCTCTCTCTCGACGAAAGCGTTGCAATCATCG
GTACG
TCTCAAGGCTTTTCTTTCCAGCAAACTTTCCAAGGACAATTGATCCGAACTTCTGTACTTTTGCATTCCAGGAGCTCACACAATTGGAGTCGGGCACTGTGTCAACATTGTGAATCGGCT
CTATCCAAACCAGGACAGTAAGATCAGTCTCCTGTTTGCGAGCCGGCTGAGAGTCCAGTGCCCGACGGCCAATCCCTGGATGCTCAACAACATTACAGTGATCAACAACGATATGACCAA
CCTCGTCTTTGACAACCAGTACTTCCGGGACCTTATAGCGCGCTTCTCCACGAACCAGCAGCTCTTCCTCAACACATTCTCTTCGGCTTTCGTCAAGCTCACGTCCAGCAATGTCTTGAC
AGGACAGAGTGGACAGGTTCGAAAGTACTGCCACTCAGTGAACTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
GGTTGCGACGCGTCCATCTTGCTCGACTCGAAAGGTTCCATCAAAAGCGAAAGAGACTCGGACAAGAACTTTGGCATCCGCCGCTTGGATTTCATCGACAGGATCAAGTTGATGCTGGAG
GCCGCCTGTCCGGGAGTCGTCTCGTGCGCGGACATCATCGTTCTGGTGGCCAGAGAATCCATCGTCTTCACCGGAGGCCCGACAATCCCCATGCTCACAGGAAGAAGAGACAGCACAGCC
GCTTCCAACGCCGCAGCCGACAGGCTGTTGCCTCCAGCAACCGTAAGCGTCGACAACTTCATCAGCCTCTTCGCATCCAAGGGCCTCTCTCTCGACGAAAGCGTTGCAATCATCG
GAGCT
CACACAATTGGAGTCGGGCACTGTGTCAACATTGTGAATCGGCTCTATCCAAACCAGGACAGTAAGATCAGTCTCCTGTTTGCGAGCCGGCTGAGAGTCCAGTGCCCGACGGCCAATCCC
TGGATGCTCAACAACATTACAGTGATCAACAACGATATGACCAACCTCGTCTTTGACAACCAGTACTTCCGGGACCTTATAGCGCGCTTCTCCACGAACCAGCAGCTCTTCCTCAACACA
TTCTCTTCGGCTTTCGTCAAGCTCACGTCCAGCAATGTCTTGACAGGACAGAGTGGACAGGTTCGAAAGTACTGCCACTCAGTGAACTAG

Retrieve as FASTA