Entry information : SmPrx65-2_30 (SmPrx65b_30)
Entry ID 7967
Creation 2011-02-02 (Toky Ramarohetra)
Last sequence changes 2011-03-02 (Toky Ramarohetra)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2011-08-11 (Christophe Dunand)
Peroxidase information: SmPrx65-2_30 (SmPrx65b_30)
Name (synonym) SmPrx65-2_30 (SmPrx65b_30)
Class Class III peroxidase    [Orthogroup: Prx228]
Taxonomy Eukaryota Viridiplantae Streptophyta Isoetopsida Selaginellaceae Selaginella
Organism Selaginella moellendorffii    [TaxId: 88036 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SmPrx65-2_30
start..stop
S start..stop
SmPrx24-2_30 654 0 1..326 1..326
SmPrx24-1_80 580 0 1..326 1..327
SmPrx52-1_16 323 3e-110 8..326 32..346
SmPrx52-2_1 323 4e-110 8..326 32..346
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1427851..1428270 420 N° 2 1428357..1428522 166 N° 3 1428577..1428971 395  
join(1427851..1428270,1428357..1428522,1428577..1428971)


exon

Literature and cross-references SmPrx65-2_30 (SmPrx65b_30)
DNA ref. Phytozome 12:   scaffold_30 (1427851..1428971)
Protein sequence: SmPrx65-2_30 (SmPrx65b_30)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   326 (305)
PWM (Da):   %s   34564.76 (32331.5)  
PI (pH):   %s   8.41 (8.41) Peptide Signal:   %s   cut: 22 range:22-326
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAGRISMLLLLLPVLVPVMDAAAGGLTPGFYQQSCPNAESMTRSTVQRLTLLDPTLSAALVRLVFHDCQVQGCDGSILLATTKNQSFSPVTTSELASSNNFGIRRLDAIDRIKSVLEASCPGVVSCADIVVMAARDAIALSGGPTIPILTGRRDGTTASAKQADDSLFPPQTPLDRVLSVFQSQGLDTVDTVALLGGHTLGVSHCPSVVNRLYPRMDSSLPLGFGASLRLRCPATIPMNNLSIIANDFTNLAFDNRFYSDVIAGTGVLTVDQQLASDPRTRGIVNQFAADRAAFFRAFARGFQKMSHLNVLTSNAGQVRRSCRTAN

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCGGAAGAATCTCAATGCTGCTCCTGTTGCTTCCAGTTCTTGTTCCGGTGATGGATGCAGCAGCAGGAGGCCTGACCCCGGGATTCTATCAGCAGAGTTGTCCGAACGCCGAATCC
ATGACACGTTCCACAGTCCAGCGACTGACCCTGCTCGATCCAACTCTCTCCGCTGCGCTGGTCCGCCTAGTCTTCCACGACTGCCAAGTCCAGGGCTGCGATGGATCCATCCTTCTCGCC
ACCACCAAAAATCAATCCTTCTCGCCGGTCACCACCAGCGAGCTCGCCTCCTCCAACAACTTTGGAATCCGGCGACTGGACGCCATCGACCGGATTAAGTCGGTGCTCGAGGCCTCCTGC
CCTGGCGTTGTGTCGTGCGCGGACATCGTCGTCATGGCTGCCCGGGACGCCATTGCTCTG
GTAAGACAACAAAAGTTTCCATCATTTCGGAAGAAAGAAAGAATGCGAAAGAGCTGACCA
TTCTGATCTCGCTTGGATTTTCACAGTCTGGAGGGCCGACGATACCGATCCTGACCGGCAGAAGAGATGGAACCACAGCCAGCGCCAAGCAAGCCGACGATTCTCTTTTCCCGCCACAAA
CTCCGCTCGATCGGGTGCTCTCCGTCTTCCAATCGCAAGGCCTCGACACGGTGGATACAGTAGCGCTGCTCG
GTATTTCACGCCTGCTCGACCTTCTTGCCCGTAATATCGTTCGATCTT
GCGCAGGAGGCCACACCCTGGGAGTGTCGCACTGCCCTAGCGTCGTCAATCGCCTCTACCCGCGCATGGATTCATCGCTGCCGCTGGGATTCGGCGCGTCGCTGCGCCTGCGCTGCCCGG
CCACGATCCCGATGAACAACCTCAGCATCATCGCCAACGATTTCACAAACCTGGCCTTCGACAATCGCTTCTACAGCGATGTGATCGCCGGCACCGGCGTCCTCACGGTCGATCAGCAGC
TCGCCAGCGATCCGCGCACCCGCGGCATCGTCAATCAATTCGCCGCCGACCGTGCCGCCTTCTTCCGCGCATTCGCGCGAGGGTTCCAGAAAATGTCCCACCTCAACGTGCTCACGAGCA
ATGCCGGACAAGTACGGCGGAGCTGCCGTACAGCCAACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCGGAAGAATCTCAATGCTGCTCCTGTTGCTTCCAGTTCTTGTTCCGGTGATGGATGCAGCAGCAGGAGGCCTGACCCCGGGATTCTATCAGCAGAGTTGTCCGAACGCCGAATCC
ATGACACGTTCCACAGTCCAGCGACTGACCCTGCTCGATCCAACTCTCTCCGCTGCGCTGGTCCGCCTAGTCTTCCACGACTGCCAAGTCCAGGGCTGCGATGGATCCATCCTTCTCGCC
ACCACCAAAAATCAATCCTTCTCGCCGGTCACCACCAGCGAGCTCGCCTCCTCCAACAACTTTGGAATCCGGCGACTGGACGCCATCGACCGGATTAAGTCGGTGCTCGAGGCCTCCTGC
CCTGGCGTTGTGTCGTGCGCGGACATCGTCGTCATGGCTGCCCGGGACGCCATTGCTCTG
TCTGGAGGGCCGACGATACCGATCCTGACCGGCAGAAGAGATGGAACCACAGCCAGCGCC
AAGCAAGCCGACGATTCTCTTTTCCCGCCACAAACTCCGCTCGATCGGGTGCTCTCCGTCTTCCAATCGCAAGGCCTCGACACGGTGGATACAGTAGCGCTGCTCG
GAGGCCACACCCTG
GGAGTGTCGCACTGCCCTAGCGTCGTCAATCGCCTCTACCCGCGCATGGATTCATCGCTGCCGCTGGGATTCGGCGCGTCGCTGCGCCTGCGCTGCCCGGCCACGATCCCGATGAACAAC
CTCAGCATCATCGCCAACGATTTCACAAACCTGGCCTTCGACAATCGCTTCTACAGCGATGTGATCGCCGGCACCGGCGTCCTCACGGTCGATCAGCAGCTCGCCAGCGATCCGCGCACC
CGCGGCATCGTCAATCAATTCGCCGCCGACCGTGCCGCCTTCTTCCGCGCATTCGCGCGAGGGTTCCAGAAAATGTCCCACCTCAACGTGCTCACGAGCAATGCCGGACAAGTACGGCGG
AGCTGCCGTACAGCCAACTAA

Retrieve as FASTA