Entry information : AImeEPO
Entry ID 7971
Creation 2011-02-03 (Christophe Dunand)
Last sequence changes 2011-02-03 (Christophe Dunand)
Sequence status complete
Reviewer Catherine Mathe
Last annotation changes 2011-02-04 (Catherine Mathe)
Peroxidase information: AImeEPO
Name AImeEPO
Class Eosinophil peroxidase    [Orthogroup: EPO001]
Taxonomy Eukaryota Metazoa Chordata Mammalia Ursidae Ailuropoda
Organism Ailuropoda melanoleuca (Giant panda)    [TaxId: 9646 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AImeEPO
start..stop
S start..stop
PtroEPO 1326 0 18..730 1..713
GgoEPO 1325 0 18..730 1..713
HsEPO 1324 0 18..730 1..713
EcabEPO 1323 0 2..730 9..737
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1..127 127 N° 2 237..330 94 N° 3 559..734 176 N° 4 907..1024 118
N° 5 1145..1274 130 N° 6 2072..2278 207 N° 7 3705..4023 319 N° 8 4679..4839 161
N° 9 5226..5481 256 N° 10 5920..6090 171 N° 11 8268..8505 238 N° 12 9086..9287 202
join(1..127,237..330,559..734,907..1024,1145..1274,2072..2278,3705..4023,4679..4 839,5226..5481,5920..6090,8268..8505,9086..9287)


exon

Literature and cross-references AImeEPO
Protein ref. UniProtKB:   D2I2K2_AILME
DNA ref. GenBank:   NW_003219128.1 (294426..285140)
mRNA ref. GenBank:   XM_002929408.1
Protein sequence: AImeEPO
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   732 (693)
PWM (Da):   %s   82416.93 (78509.8)  
PI (pH):   %s   10.61 (10.79) Peptide Signal:   %s   cut: 40 range:40-732
Sequence 773
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MWVSIPCPAVVGGLTAEMKLFLALAGVLATLILAPACEGTGPAPPAAVETSVLRDCITEAKLLVDAAYNQTQRSIKERLRSGLASPMDLLSYFKQPLAATRTAVRAADYMHVALELLEGKLQPQGSSSFNVTDVLTEPQLRLLSQASGCAVQDQEEKCSDKYRTITGRCNNRRRPWLGASNQALARWLPAEYEDRLSLPFGWTPNRRRNGFLLPLVRAVSNQIVRFPNERLTSDRGRALMFMQWGQFIDHDLDFSPESPARVAFTAGVDCEKTCAQLPPCFPIKIPPNDPRIRNQRDCIPFFRSAPACPQNRNKVRNQLNALTSFVDASMVYGSEVSLALRLRNRTNFLGLLAVNTRFSDNGRALLPFDTLRDDPCLLTNRTARIPCFLAGDSRSSETPKLAAMHTLFMREHNRLATELKRLNPQWTGDKLYQEARKIVGAMVQIITYRDFLPLVLGEARARRTLGPYRGYCSNVDPRVANVFTLAFRFGHTMLQPFMFRLDSQYRASAPNSRVPLSTSFFASWRVVLEGGIDPILRGLMATPAKLNRQDSMLVDELRDRLFQQVRRIGLDLAALNMQRSRDHGLPGYNAWRRFCGLSQPRNLAQLSRVLQNPGLARKFLNLYGTPDNIDIWIGAIAEPLLPGARVGPLLACLFENQFRRARNGDRFWWEKRGVFTKRQRKALRQISLSRIVCDNTGITIVSRDIFRANTYPQGFVSCTRIPRLNLSAWRRR

Retrieve as FASTA  
Remarks complete sequence from genomic. Protein sequence may be shorter in N-term (compraison with other sequences let think tranlation start on M downstream)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGTGGGTGTCGATCCCTTGCCCCGCTGTGGTCGGGGGCCTCACTGCGGAGATGAAGCTGTTCCTGGCCCTGGCAGGGGTCCTCGCCACGCTCATCCTGGCCCCAGCCTGTGAGGGCACTG
GCCCCG
GTAATATACCTTTGGGCAGCCAAGGAGGAGAGCAATGGAGGGGGAGGGATTTGGGTCTGGGGGGAGCCCGTGGCTCCCCTGGACCCTGAGTCCCCTTCCCTCTGAACAGCACCC
CCTGCGGCAGTGGAGACCTCGGTCCTTCGGGACTGCATAACGGAGGCCAAGTTGCTGGTGGATGCCGCCTACAATCAGACTCAGCGGAG
GTGGGTCTGGAAGGGTCAATGAGGTGGGTGG
GCTCCAGCCACGGTCATGTCAGCCATCACCCTGCCCCTGGGCACCTTGGGGCAGCACCGTGTTGGTAGAGATCCTCTCTTCCACCCACCCTGTCGGTTCACATTGCCCTGACCGTCCACC
ACCGGGCTGGGGCACTGCTGGGGGGCTCTGCTGAGGGGCTCTGCTTCCCTTCTCCAGCCCTTGCTCCCCTCTTGCAGCATCAAGGAGCGCCTCCGCAGTGGCCTGGCCAGCCCCATGGAC
CTCCTGTCCTACTTCAAACAGCCGCTAGCAGCCACCAGGACAGCGGTTCGGGCAGCTGATTACATGCATGTGGCCTTGGAGCTGCTGGAGGGGAAGCTGCAACCCCAGGGCTCCAGCTCC
TTCAACGTCACTG
GTACCGGGCTCCCCCCCGAGCCCCAGGGCCTGCTCTGACCTGGGAAGGCAGGGCAGACAGCCTGGGCTGTTGGGAGGGAAGAGGGTTGAGGGATGCGAGGTACGGAG
CGGCCCCGCTCAGGAAGGAGCCAGGACCCTGGACCCAGGACCCTGCCCACCTGTCCCACCCCCAGATGTGCTGACAGAACCCCAGCTGCGGCTGCTGTCCCAGGCCAGTGGCTGTGCTGT
CCAGGACCAGGAGGAGAAGTGCAGCGACAAGTATCGAACCATCACCGGGAGATGCAACAACAG
GTGGGTGCCCGGGGCAGAACCTGACCCGAGGGCGCCTCCCTCCCCCCACCCCTCCCC
CCACCCTGGGTGGTCTCTGGACCCGGAACTCCTCCTGACCCGAGCTCCTGCTGACTGCTGCAGGAGAAGACCCTGGCTGGGGGCCTCCAACCAGGCCCTGGCCCGCTGGCTGCCAGCTGA
GTACGAGGACAGGCTGTCACTCCCCTTCGGCTGGACGCCCAACAGGAGGCGCAATGGTTTCCTCCTCCCTCTT
GTGAGTAGCGGCTGAGTCTGGAGGGTGCTTCGAAACACGGGGAGCAA
GAGCACGGCCCAGAGCCAGTGGGCACCCAGGCTCTGCCACTGGCCGGTGAGGTGACTCTGAGCAAGTCGCACAGCCGAGTCTCAGTTTCCTCATCTGTAAAATGGCAGTAAAACCCACCT
CCTATTGCTGGTGTGTGAATTATAAGGTCCTTAGTATAAACACCTACATAGGATGGGATCTAGGAATGCTAGCCATTATAGTATTGCTTTTTCTCAAAGAATCAGTACCGAAGTATCTAG
CTAAATGTAAAGAGTGTATGTCTTATTCTACCTATGTCTATTGATCTAAATGATTTCACATTGATCAGCTATCAATTTTCTAATCATACGTCAGTATGACAAGCACCTACTCTTCTACCG
ATATCTATTTATCAATTCTTCTTCCATCTCTCTCTCCAATTCCCTCTGTATTTATTATCCAGCCCCCACCAACTGGTTCGTGCATCTCTCGGTCACTTCTGTCATCTAGGTACCCATTAG
TCTATAAACCGATCTGTAGATTCGATCTATTTACCTCTCTGGAACAGCTGGTGGGGTCTCAGCCAGCCTGGCCTCTCCCCTTCTCTACTCCTGGAATCCTCAGGAGCCGCACCAGAGGCC
ATCCTTGTAGGCATGACAGCCAGCAGGGGGTGGGACAAAGTAGGGCTGGGGAGCGGAGGGCAGGAGAGGAGGAGAGACCGTGTTCACGCCAGCGGGGGCAATCTGCCGAGCTGGCCGGGG
ATGCCCCACGCTGACCTCTCTCCCCACCAGGTCCGAGCGGTCTCGAACCAGATTGTGCGCTTCCCCAACGAGAGGCTGACCTCCGACCGGGGCAGGGCCCTTATGTTCATGCAGTGGGGC
CAGTTCATTGACCACGACTTGGACTTCTCCCCTGAGTCCCCAGCCAGAGTGGCCTTCACTGCGGGCGTGGACTGCGAGAAGACCTGCGCCCAGCTGCCCCCCTGCTTCCCCATCAAG
GTA
CCCCAGCCAGCCCTCAGGGCCCCAGGCCAGGAGCTGGGGGTGGGGGTCTGTAAGACTAAAGCACCCTCCTTAAGGAGCTGTCTGTGATGCTGGGGTATCAGACAAAGGTGAGGGGCCCGG
CCCTGTACAGACCCCTAGTTCTGTGCATGCTTGCAGGGTGGGGTGGGGGCGGGGCAGTCTGCCAGCAGGTTTAGTGCAGACTTCACGGAGGAGGACGCAGTGGAGACCAGCCTTGACCCA
GGGGTCTGATCGTGACAGGGGAAGCCTCTGGGCTGCTGCTTTTGAGAGCCTTTAGGGACTCTTAGCTCTTGCCCTTCTCTCCTTCCTGAAGAGGTCCAAGGGCCCTGCAGCTCTCACCAG
CTCCTGGGACGGTGTTGTGAGCAGGGCGCTATCCTTCAGGCTGAAAGGCAAGCATGGTGTGGAACATGAGGGAAGGAAAGACGGACTCCAGGGAGCACAGCCTATCTGGGGCAAGGGTGG
GGGGATGCGTGGGCATACCCTCCCCATTCATTCACCCCTAACAGGTAGGGTGACATTTGTGGATCATGACACGTGAAGGGCTCGTGGCTGGCCCCTTCCTCGTGCAGACTTCCCCACTCC
TCAAGCTCCGGGGCAGGGACACCTCCTCGGGGGGATCATCCCATATTTTCCTAGAGCACCTTTTGCTTCTGGCTTTTAAATCAAGCATAGCAAATAGCATCTCAGTTTAGAGTTACAGTC
TCTATGTGTGTACCCGTTTGCACTGAGTGCCAGCTTCCTGCAAGCTGTGCTGGGTTTTGTTGACCTTTGTTGGTCACCAGGGCACCCGGCATAGAACGGCGTTTAGGAAATGCCTGTAGA
ATTCGATGGAATGACAGGAGCACAGGCCCAAATGTCAGGAGAATTAGGTCTTAATCCTTCCTCTCCTGCTAGCGAGGTGTCACTTCCTGTCTCTGAGCCTCAGTTTCTGCATCTGTAAAA
TGAGGATCCTTCCATGACTCTATGATACAAAGTGCTAAGGGGGCGCCTGGGTGGCTCAGTCGTTAAGCATCTGCCTTCGGCTCAGGGCATGATCCCGGCGTTCTGGGATCAAGCCCCACA
TCTGCCTTCAGCTCAGGGCGTGATCCCGGCGTTCTGGGATCAAGCCCCACATCAGGCTCCTACGCTGGCAGCCTGCTGCCTGCTTCTTTCTCTCCCACTCCCCCTGCTTGTGTTCCCTCT
CTTGCTGGCTGTCTCTCTCTCTATATCAAATAAATAAATAAAATAAAATCTTAAAAAAAAAGAAAGTGCTAAGGAGGCTCAGATTGACCTGGTGAGCCCAGGAGTCTGGGTGCATGGAGG
AGGGCTTCCTAGAGAAGGGGAGTTTCAAGCAAGGTTTGGAATGATCAGAGGAGGGAGCTTGCTCTTGAGGGGCCCCACATCACTGGCTCCGCTTCCCCCTCAGATCCCGCCCAATGACCC
CCGCATCAGGAACCAGCGTGACTGCATCCCCTTCTTCCGCTCGGCACCCGCGTGCCCCCAGAACAGGAACAAAGTCCGAAACCAGCTCAATGCGCTCACCTCCTTTGTGGATGCCAGCAT
GGTGTACGGCAGCGAGGTCTCCCTCGCCCTGCGGCTCCGCAACCGGACCAACTTCCTGGGGCTGCTGGCCGTCAACACCCGCTTCAGCGACAACGGCCGGGCCCTGTTGCCCTTCGACAC
CCTGCGTGACGACCCCTGCCTCCTCACCAACCGAACAGCGCGTATCCCCTGCTTCCTGGCAG
GTCAGCCCCCCGTGGTCGACTGAACCATAGATTAAATAAGATCTGGTGCAAGAGGGTT
TCATTCAAAGCCAGCAAGTGACCGTGTGTAGGGCCCCCCTTCAGGAGTTTGCTTTCCTGCCGGGCCTGCAGGAGAAGCGCCGGCTCCAGGAACAGGCTCTGCCCGATCCTCTCTCTTTCC
CCTGGGCTCCGTGGGGATGAGCAGCCGGATCCCAATCCACAGCTGGGGAAAGGCTAGCTCCTGGTGGAGAACTGGCTGCAGTTCACGGGACAGGTGGGCTCGCAGTCCCAAAGTCAAGGT
TCCTAGAGTCATCTGGGTCCCTCTGCCAGCTGTGGACCTGGTCACTTGTAGGATAGAATCGTTAGGCCCAAGACTAGCCGCCCTGTGCTTTCCCACCTTGCCTGACCCTGTTTCAGTAAC
TCAGGGATCTGAGACCCCGCTGCCTCCCGCTCCTGACCCACTGTGCGGGGGTGGAGGGTGGCAGTCAGTGAGGAGCCTCATAGCACAGCTGAGGAGATGGAGGTCCGGTGAGGGCCCGGA
GCTCGGCCCGGGGCCCCAAGTGCTGCCACCTCGTTCTAGTCCCCAGAGCTGTCTACCTTAGCAGAAAGTCGTTTCTCTGGGAAGGGCTGTGGTGACTCTGAACTCGCGGTTTTCAAGGTG
ATTCCCGATCATCAGAAACCCCCAAACTGGCGGCTATGCATACCCTCTTTATGCGGGAGCACAACCGGCTGGCTACGGAGCTGAAGCGTCTCAATCCCCAGTGGACTGGAGACAAGCTGT
ACCAGGAGGCCCGGAAGATCGTGGGGGCCATGGTCCAG
GTAAAGAGCCCTGGGCCCCAGCAGTCCCTAGAAGACAATCCAGCATGAGACACCATTTGAGAAAGTGGCTCCCATTTTCCTT
AATACGTTCTTTGGGGCTATGCCTCAACTCAGCTAGATTGGGGTGATGGAGAGTGTACCTGAGATCTGGCCTATATCCCAAACTCTGCCACTAACTCACTGTGTGACACTCTCCTTGTCA
CCCCGTTCTCTGGGCTTTGGGATCTTCATCAGCCAACAGCGAAATGTATATTTCCACATTTGACACGATGGCAATAAAGAATTGGTATTCTGAGCAGCCCTTCAGAAAGCAAAGGTTTTG
TCCAAAGGCAAGGGAAGGGGGTGGGTGGCCGCTAAGGTAACGTTCCTCCTGCCTTCCCTTGTAGATCATCACCTACCGAGACTTTCTGCCCCTGGTTCTGGGCGAGGCCCGGGCCAGGAG
AACCCTGGGGCCCTACAGGGGGTATTGCTCCAACGTGGACCCTCGTGTGGCCAACGTCTTCACCCTGGCCTTCCGCTTTGGCCACACCATGCTCCAGCCCTTCATGTTCCGCTTGGACAG
CCAGTACCGGGCCTCAGCACCCAACTCACGTGTCCCGCTTAGCACCAGCTTCTTTGCCAGCTGGCGAGTCGTGCTTGAAG
GTGACCAGGTTTTAAAAGCGGATGGGAATGGGAGTGGGGC
CAAGCTTAATGGCAGGAGGCCGGGCCGCCGCCACTGAGGCCACTGCTGATCATCTCCCTGGGGCACTGCAAGCAGGTGCACCAAGACCCTCAGGCCTGCACCTCCCATCCCCTCAGGGAT
CAGAGGATTTCTCAAGGGAGGAGCCTCAGGTCAGACTATGGGCTTGTGGGCCTAGCAGGAGGTTGCCTTCTGCTCCTTCTTTAAGAAGCGGGGGTGACTGCTTTCCTTGCCAGCCCTGGC
TCCCCTCAAGTCTACCCAGGCCTTCGCTTCCTGATACAAACATGACAGGATATAAGCCACTGGCTTGTCCAGTGCTGAGCTAGCTTGGCGTCCCGTGATGACCCAGGGGCTCCCCAGAGG
CTGATCCAACCTGTGCTGCTCACATTCCCCGCCACCAGGTGGCATCGACCCCATCCTCCGAGGCCTCATGGCCACCCCTGCCAAGCTGAACCGTCAGGACTCCATGCTAGTGGACGAGCT
GCGGGACCGGCTGTTCCAGCAAGTGAGAAGGATCGGGCTGGATCTGGCAGCTCTCAACATGCAGCGCAGCCGGGACCACGGCCTCCCAG
GTGAGGGGCCTGGCCTGGGGGTGCTGCTGGC
GGGGGGCGGGGGCAGCTTTCAGAGAAGACCCTTGGTGCAGCCTTTCTGGCTGGAAACGTCTACCCCGTGTGCTGTGGTTCAGAAGCATGCGAGGCTGAGCTCGATGCAGTCAAGCCTCCC
TGGGACCACCCTTTGGCCATCCTGCCACGTCTTCGCCCGCCACTGTAGGGCCTCTAGCTGTAGGTTCCCAGCACGGCCAGGACCTGGACACAGGAGTGGACAAAGCAGATTAGAGCTTTC
CAGGGGGAGAAAACAGTAGGTTCAAAGGGCAGGGAAGAACTGCTCCAGTCCCCACTACCCTGGCGAGTTTCAAGGAGGAAGACTCAATTCCAGGGACATAGGAACTGGCTCCTAGCTCTA
AGTGCAGAAAGGCAAAGAGCCCAAGAGGCGGGAACAGGTGGAGTGAACCGGTGACGGCCTGGGCTGTTTCCTGAGGGCACACCAAAATCCCAGGAAAGAAGAAAAATGTATCCCAAGGAA
GAAGAAAATGTAGCCACTTTGCCAGGAATTTTCACAGCTATTAATCATTTTGTTCTGCCAGGGACCTTGAGAAGCAACTATTACAGCTGTTTTTATAGATGCGGAAATAAGCTCAGAGAC
ATCTAGTCATTCTCTCAAGGCCACATAACTAGGGAGTAGTAAATTTTGAATCAAGTTCCGAATTTCTCCTTTCTTCCCCCTGTGCAAGCCATAATGTTAGGGGAAGGCTTTGGTCACGGC
CTTGCTCCCCTCTCCCTCTCCCCTCCTTTCCTGTCTAAATACAACCTGAAGCCTCGTCTGCCTCGGCTCCTCTGCGGCTGTGTAGAATGGGGAGGGGGGGCGGGGGATAATCCCCACCAC
AGCGCGGCCCAAGAGCCTGTTTCTTTCCTCCTTTCACTTGGGCGCCCCCTGCTGGACAACTGAGATTGCCAGCCACCCAGCTGCCGCATAGTGCGTTTCTGTGCCACCCCCCCCCTATAA
TTTTTCCTCCAAGCTGTCCCAGAAATATTATCCGGATACTAGCTCTGACAGTGTCCTCCAATCCCTTCCAAAGTCCAACACCGAATTTGGGATTGGAAGAGCTTGTCTGAAATCCACTTA
CTGGTGGAGTGACCTTAACAAAGTCACAGTTGCTCAAGCTCAGCAAGTATCCATCGATAAGACGGAGACTACAAAGTGCCTCACGCAGGTGGTGTGAGGACCCTGAGAGACTCTCGCACA
CCAGTGCTTAGTGAGGTAAAGCATTACATCACTTCCTTTGCTCAGCTGGAAGATGGTGAGTTGTTGTTCAATGGACAATATTGGGCAGGTGATTCTTCAAGGTCAGGGCAAATCTAACTC
CTATCTTGATGGTCCCTGCCCCACCTTCTGGCTTGGGCCTGGTGCAGGATCCTACTAGCAGAGAAATCAGAAGGCTGGCCTTTAGGAGTTTCGGAGTAGATGAAAAAAAAATTCAAACAG
CTTTATTGGGATATAATTAGCATATCATAAAATTCACCCATATGAAGTATACGATTCGATGACTTCCGTATATTTAGAGTTGTGCGTTGATCACTTTTTGGTGGGGGAGGGGTCTGTTAA
GGCCTTTGGTCCACTGATCACCATTGCTAATGTCAGAACATTTTCATCACTCTCAAAAGAAACCTTACAATAACAGTCACTCCCTGTCCCCACCCCAGCCCTTGACAATCACTGATTATC
TCTACATAGTTGCCTATTCTGGACCTTTCACATAAATGGAATCATGCAGCATGTGGTCCTCTTCTGAATAAACTTTGACCACACTCTTCATTCCTTGGTTTGTTCACCTATGTATTGGTT
CATTCCTTCCTTCTCTAAACCTGAGGAAGTCTTTTATGTTCTGGATCTGTCTTATTTGTACCTCATTGATGCACTTGAGGCCAATAATAATATACTTGTGGTACCGGGGGTTATAGCAGG
ACACACTCCTCAGTTTGGTGAGCACAAAGCATGGTTTGTCTACGCGCTTTGAAAACTAGAAGGCAGTGGCTTGATCTTTGGAAGGTTTGACCTTTTCCGTCAGCAGGGATCTTGTTCTGA
CTGACATTTCCTGACCACAGAGCTCTCTCGGGAGAAACTGGAGCAGCAGAAGCTAAGGGAAATCAGCAGGGTAAGGCTGAACCGCCTCTGCCCCCTTTCTCTACAGGGTACAATGCCTGG
AGGCGCTTCTGTGGCCTCTCCCAGCCCCGGAATCTGGCACAGCTTAGCCGGGTGCTGCAAAACCCAGGTCTGGCAAGGAAGTTCCTGAATCTGTATGGGACACCTGACAACATTGACATC
TGGATTGGGGCCATCGCAGAGCCTCTTTTACCAGGGGCCCGAGTGGGGCCTCTTCTGGCTTGTCTTTTTGAAAACCAGTTCAGGAGAGCCCGGAATGGTGACAG
GTAAGGGACCCTCCCC
TAAAAAGACCGGCCCCAGAGGCAGGGCAGAAAAGCGCTAGCATGTCAAGACTCAGCAAGGGGGAAAGTGCCCTTTTTAGATCGTTTCTTCTAAGTTCGCAGGGTCTGAGACCAGGACGCT
CCTCTGTGGAGAGCTTGGTCAGAGTGAGAGAGACCACGGGCCAGGCAAGGCGGATGGTGCCTGGGCTACAGGCACCTTTAACCCACAAAACAGACTTGTCAGCCCCACTGTTCAGCTAGT
GGGTCCCAGAAAACATGGGCGGAAAGGGCTAAATCTGGTTTCTTCCCAATAAAGCTTATGGCCTAAGACCCGACTCCTTATTTGGATTTGGCATTTACCCAGGTTCAAATCCAGCCCTAG
ACACTTAAATTACTGTGCACTTAATACCAAGCAATTTCCTTGAGCGCTGAACCTGCTTCTTCGTTTATAAATAGGGAATAATACTATTTTGCAGGAATTCTGGAGAACTGAATGAAATAA
TGTGAAGTACCTGGCATACAACAGGTGCTCATTGTGTTCATTCCTCCCTCACCTTCACCTGTATCTCTCCACGTGTCTCGGTAGGTTCTGGTGGGAAAAAAGGGGTGTTTTCACCAAGAG
ACAACGCAAGGCCCTGCGCCAGATTTCCTTGTCTCGAATTGTGTGTGACAATACCGGCATCACCATCGTTTCGAGGGACATCTTCAGGGCCAACACTTACCCGCAGGGCTTTGTGAGCTG
TACCCGCATCCCCAGGTTGAACCTCTCAGCCTGGCGACGCAGATGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGTGGGTGTCGATCCCTTGCCCCGCTGTGGTCGGGGGCCTCACTGCGGAGATGAAGCTGTTCCTGGCCCTGGCAGGGGTCCTCGCCACGCTCATCCTGGCCCCAGCCTGTGAGGGCACTG
GCCCCG
CACCCCCTGCGGCAGTGGAGACCTCGGTCCTTCGGGACTGCATAACGGAGGCCAAGTTGCTGGTGGATGCCGCCTACAATCAGACTCAGCGGAGCATCAAGGAGCGCCTCCGCA
GTGGCCTGGCCAGCCCCATGGACCTCCTGTCCTACTTCAAACAGCCGCTAGCAGCCACCAGGACAGCGGTTCGGGCAGCTGATTACATGCATGTGGCCTTGGAGCTGCTGGAGGGGAAGC
TGCAACCCCAGGGCTCCAGCTCCTTCAACGTCACTG
ATGTGCTGACAGAACCCCAGCTGCGGCTGCTGTCCCAGGCCAGTGGCTGTGCTGTCCAGGACCAGGAGGAGAAGTGCAGCGACA
AGTATCGAACCATCACCGGGAGATGCAACAACAG
GAGAAGACCCTGGCTGGGGGCCTCCAACCAGGCCCTGGCCCGCTGGCTGCCAGCTGAGTACGAGGACAGGCTGTCACTCCCCTTCG
GCTGGACGCCCAACAGGAGGCGCAATGGTTTCCTCCTCCCTCTT
GTCCGAGCGGTCTCGAACCAGATTGTGCGCTTCCCCAACGAGAGGCTGACCTCCGACCGGGGCAGGGCCCTTATGT
TCATGCAGTGGGGCCAGTTCATTGACCACGACTTGGACTTCTCCCCTGAGTCCCCAGCCAGAGTGGCCTTCACTGCGGGCGTGGACTGCGAGAAGACCTGCGCCCAGCTGCCCCCCTGCT
TCCCCATCAAG
ATCCCGCCCAATGACCCCCGCATCAGGAACCAGCGTGACTGCATCCCCTTCTTCCGCTCGGCACCCGCGTGCCCCCAGAACAGGAACAAAGTCCGAAACCAGCTCAATG
CGCTCACCTCCTTTGTGGATGCCAGCATGGTGTACGGCAGCGAGGTCTCCCTCGCCCTGCGGCTCCGCAACCGGACCAACTTCCTGGGGCTGCTGGCCGTCAACACCCGCTTCAGCGACA
ACGGCCGGGCCCTGTTGCCCTTCGACACCCTGCGTGACGACCCCTGCCTCCTCACCAACCGAACAGCGCGTATCCCCTGCTTCCTGGCAG
GTGATTCCCGATCATCAGAAACCCCCAAAC
TGGCGGCTATGCATACCCTCTTTATGCGGGAGCACAACCGGCTGGCTACGGAGCTGAAGCGTCTCAATCCCCAGTGGACTGGAGACAAGCTGTACCAGGAGGCCCGGAAGATCGTGGGGG
CCATGGTCCAG
ATCATCACCTACCGAGACTTTCTGCCCCTGGTTCTGGGCGAGGCCCGGGCCAGGAGAACCCTGGGGCCCTACAGGGGGTATTGCTCCAACGTGGACCCTCGTGTGGCCA
ACGTCTTCACCCTGGCCTTCCGCTTTGGCCACACCATGCTCCAGCCCTTCATGTTCCGCTTGGACAGCCAGTACCGGGCCTCAGCACCCAACTCACGTGTCCCGCTTAGCACCAGCTTCT
TTGCCAGCTGGCGAGTCGTGCTTGAAG
GTGGCATCGACCCCATCCTCCGAGGCCTCATGGCCACCCCTGCCAAGCTGAACCGTCAGGACTCCATGCTAGTGGACGAGCTGCGGGACCGGC
TGTTCCAGCAAGTGAGAAGGATCGGGCTGGATCTGGCAGCTCTCAACATGCAGCGCAGCCGGGACCACGGCCTCCCAG
GGTACAATGCCTGGAGGCGCTTCTGTGGCCTCTCCCAGCCCC
GGAATCTGGCACAGCTTAGCCGGGTGCTGCAAAACCCAGGTCTGGCAAGGAAGTTCCTGAATCTGTATGGGACACCTGACAACATTGACATCTGGATTGGGGCCATCGCAGAGCCTCTTT
TACCAGGGGCCCGAGTGGGGCCTCTTCTGGCTTGTCTTTTTGAAAACCAGTTCAGGAGAGCCCGGAATGGTGACAG
GTTCTGGTGGGAAAAAAGGGGTGTTTTCACCAAGAGACAACGCA
AGGCCCTGCGCCAGATTTCCTTGTCTCGAATTGTGTGTGACAATACCGGCATCACCATCGTTTCGAGGGACATCTTCAGGGCCAACACTTACCCGCAGGGCTTTGTGAGCTGTACCCGCA
TCCCCAGGTTGAACCTCTCAGCCTGGCGACGCAGATGA

Retrieve as FASTA