Entry information : SmPrx[P]73a_81
Entry ID 7977
Creation 2011-02-03 (Toky Ramarohetra)
Last sequence changes 2011-02-03 (Toky Ramarohetra)
Sequence status theoretical translation / pseudogene
Reviewer Christophe Dunand
Last annotation changes 2011-02-15 (Christophe Dunand)
Peroxidase information: SmPrx[P]73a_81
Name SmPrx[P]73a_81
Class Class III peroxidase     [Orthogroup: Prx214]*
Taxonomy Eukaryota Viridiplantae Streptophyta Isoetopsida Selaginellaceae Selaginella
Organism Selaginella moellendorffii    [TaxId: 88036 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SmPrx[P]73a_81
start..stop
S start..stop
SmPrx73-2_39 271 4.76e-93 1..154 1..156
SmPrx73-1_120 271 8.39e-93 1..154 1..156
SlPrx01 175 1.39e-57 19..147 16..146
SmPrx103-2_90 180 4.02e-57 25..154 25..156
Gene structure Fichierperl './assets/cgi-bin/draw_exon.pl' '7977' 'join(432441..432653,432720..432902,432965..433030)' Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 432441..432653 211 N° 2 432720..432902 181 N° 3 432965..433030 64  
join(432441..432653,432720..432902,432965..433030)


exon

Literature and cross-references SmPrx[P]73a_81
DNA ref. Phytozome 12:   scaffold_81 (432441..433030)
Protein sequence: SmPrx[P]73a_81
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   153 (135)
PWM (Da):   %s   15884.3 (13993.2)  
PI (pH):   %s   7.35 (7.35) Peptide Signal:   %s   cut: 19 range:19-153
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MISTYSLLLLLIATSSLAFSAEAALATG*YDSTCPQVEKIVKAGV
ANAAQSDSRLPASLLRLHFHEVSRLL
GVVLLDDTPTFQGENTARPNNNSIRGFKAIDAIKSSLESSCKGVVSCADILALAARDSVVLSGGPSWEVPLGRRGSITASFSG

Retrieve as FASTA  
Remarks Pseudogene. In frame stop codon, incomplete protein.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGATCTCTACGTATTCTCTCCTGCTGCTTTTGATCGCTACTTCGTCTCTGGCCTTCTCGGCGGAGGCGGCGCTCGCGACTGGCTAGTACGATTCGACATGCCCGCAAGTCGAGAAGATC
GTCAAGGCCGGGGTCGCAAACGCTGCGCAATCCGACTCGCGATTGCCAGCGTCGCTTCTTCGTCTCCATTTCCACGAAGTAAGTCGCCTTCTC
TCGTCCATTGGATCGGCAACAATCGAC
CGCTAACATTCGTCCCCCTGTTTGAATTTGAAATTTTCTAGGGCGTCGTGTTGCTGGACGATACTCCCACTTTCCAGGGGGAGAATACCGCCAGACCCAACAACAATTCCATCAGAGGAT
TCAAAGCAATCGACGCGATTAAATCGTCTCTCGAGAGCAGCTGCAAGGGGGTCGTGTCATGCGCGGACATCCTCGCGCTCGCAGCTCGGGATTCTGTCGTCCTG
TGGTAGGAAATTCTAG
TGATTTTCGGTGGAGTTCTTATGGAATCCCCACGGAATTTGAGCGCAGAGTGGCGGGCCGTCGTGGGAAGTGCCACTGGGGCGACGAGGTAGCATCACTGCGAGCTTCTCTGGT

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGATCTCTACGTATTCTCTCCTGCTGCTTTTGATCGCTACTTCGTCTCTGGCCTTCTCGGCGGAGGCGGCGCTCGCGACTGGCTAGTACGATTCGACATGCCCGCAAGTCGAGAAGATC
GTCAAGGCCGGGGTCGCAAACGCTGCGCAATCCGACTCGCGATTGCCAGCGTCGCTTCTTCGTCTCCATTTCCACGAAGTAAGTCGCCTTCTC
GGCGTCGTGTTGCTGGACGATACTCCC
ACTTTCCAGGGGGAGAATACCGCCAGACCCAACAACAATTCCATCAGAGGATTCAAAGCAATCGACGCGATTAAATCGTCTCTCGAGAGCAGCTGCAAGGGGGTCGTGTCATGCGCGGAC
ATCCTCGCGCTCGCAGCTCGGGATTCTGTCGTCCTG
AGTGGCGGGCCGTCGTGGGAAGTGCCACTGGGGCGACGAGGTAGCATCACTGCGAGCTTCTCTGGT

Retrieve as FASTA