Entry information : SbPrx68 (Sobic.003G436800.1 [2.1] / SB03G046760 [1.4])
Entry ID 801
Creation 2006-01-02 (Christophe Dunand)
Last sequence changes 2006-01-02 (Christophe Dunand)
Sequence status complete
Reviewer Messaoudi
Last annotation changes 2014-08-04 (Messaoudi)
Peroxidase information: SbPrx68 (Sobic.003G436800.1 [2.1] / SB03G046760 [1.4])
Name (synonym) SbPrx68 (Sobic.003G436800.1 [2.1] / SB03G046760 [1.4])
Class Class III peroxidase    [Orthogroup: Prx004]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Sorghum
Organism Sorghum bicolor    [TaxId: 4558 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SbPrx68
start..stop
S start..stop
ZmPrx16 613 0 42..377 28..361
SiPrx06 536 0 51..377 37..357
OsPrx20 489 1e-174 45..377 34..365
TaPrx23-1D 460 3e-163 46..377 36..361
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 73805018..73805503 486 N° 2 73807927..73808574 648  
join(73805018..73805503,73807927..73808574)


exon

Literature and cross-references SbPrx68 (Sobic.003G436800.1 [2.1] / SB03G046760 [1.4])
Literature Cordonnier-Pratt,M.-M. et al., unpublished
DNA ref. Phytozome 12:   chromosome_3 (73805018..73808574)
Protein sequence: SbPrx68 (Sobic.003G436800.1 [2.1] / SB03G046760 [1.4])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   377 (347)
PWM (Da):   %s   39518.2 (36771.7) Transmb domain:   %s   i12-34o
PI (pH):   %s   6.12 (5.71) Peptide Signal:   %s   cut: 31 range:31-377
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAATTTSRPAAAALPLAVLAAAMVVALAAAGDVVEQQLEVVGSRYPPLAPGLSFDFYKKSCPKAESIVKEFLSSAVRQNVGLAAALIRVHFHDCFVQGCDASVLLDSTPTQPSEQLSPPNLTLRPAAFKAINDIRARLEQACGRVVSCADITALAARESVALGGGPAYKVPLGRRDGLAAASNAAVLAALPSPTSTVPTLLSFLSKINLDVTDLVALSGGHTVGVAHCSSFSNRLFPTQDPTLNKFFAGQLYGTCPTDTTVNTTVNDIRTPNTFDNKYYVDLLNRQGLFTSDQDLLTNATTRPIVTKFAVDQNAFFEQFVYSYVKMGQINVLTGSQGQVRANCSARNAGAAGNGGEDQLPWSDVVETVVDATGSLVL*

Retrieve as FASTA  
Remarks Complete sequence from 79 ESTs and genomic (chromo 3, intron 1).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGGCTACTACTACTTCTCGTCCTGCCGCTGCTGCTCTGCCGCTGGCGGTACTGGCAGCAGCCATGGTGGTGGCCCTGGCGGCGGCCGGCGACGTCGTCGAGCAGCAGCTCGAGGTC
GTTGGCAGCAGGTACCCGCCGCTGGCGCCGGGCCTGTCGTTCGACTTCTACAAGAAGAGCTGCCCGAAGGCGGAGTCGATCGTGAAGGAGTTCCTGTCGTCGGCGGTGCGGCAGAACGTG
GGGCTCGCCGCCGCGCTGATCCGGGTCCACTTCCACGACTGCTTCGTGCAGGGCTGCGACGCCTCCGTCCTGCTCGACTCCACGCCCACCCAGCCCAGCGAGCAGCTGTCGCCGCCCAAC
CTTACGCTTCGGCCGGCGGCGTTCAAGGCCATCAACGACATCCGCGCCCGCCTCGAGCAGGCCTGCGGCCGCGTCGTCTCCTGCGCCGACATCACCGCCCTCGCCGCCCGTGAATCCGTT
GCCCTG
GTACCTACTATACGCGCGTGCAATTGCTTATTTGTTTGCTTTATTTATTCATCTGCGCACAGCAAAAGTAAAGTTATCCAAAAATATATATTCAAATGATGCTGTAGTTGCATG
CTGCATGCATCCCACTCACTTTGTTCTACACTTTTCCGGCCTTCTTGTTGTTTAAATTTAAACCAGTGTTTTAAATAGCGTGCTAAGCTTCTTAGCGGCAGCCTCTCTAAAAGGCTAAGA
AAAGCTATAGCGCGCTAATAGCGGGCTAAGCCATTTAGCGGCTGAGCAAAAAATATGTCAAACATCATGTAATTTTACACATAATAAAGATGAAAACATTATGAAGACCAATAGTGATAG
ATATTTCAAAGGGTTACTAACATATTACATCAAAGTTCGTAGTTCATACATGATACATCAATAATAACATACATCACATAGGGGTATATCTCTGCTATTTGGGCCTCCAAGTTATTTGGG
TCGATAGAAATGAATCCTAAGACCAAATAGCGGCGCTAAACTAACTCAATTTAGCAAAATTAGCGCGCTATTAGCTGCTAATAGCGGGAACAATCATTTAGCGTTAAAATCCCCATAGCT
TAGCAGTCCTCTTCCACAAACGCTAAATAGCGCTATAGCGTCCGCTATAGCGCGCTATTTAGAACAGGATTTAAAAACACACACGCATAGCCCATCTTATGCCGTGTGGTACATGTAACT
TCACATGCATGGCCCCTACCTACATCAAACATGGCAAGAGTATACGTAGTGGAACAAAAAAAGTACTTTTTAGGCACAAAAGTGTTTACACATATATATCCTCATCAATTTAAAAAAAAT
ACTCCATACTCATAAAAAAAGTTGTTTTAGATAAAGTTGATCGGCGGCGACAAGCTAAGCCATGCATGTTGGTGGTTTGGTCGTTGCGGCAGCAATAGTTATTAATTAGTCAGTGATATG
ATGGTTATCTGTGCGTGGCGGTACTGCGGTAGTGGTACGACTGGATCGAGTTTTGCGTGCAGCCAGTTTCAGGGGTCTTTTTTTTTTCCTACATAGATATTTTTCCCATGAGTTGAAACC
TCTAGAGTTAATCTACCTCTGTATGCATCTCCTTGTTTCAGTGCTAGAGATATAGTTTAGGGCACTCACAATGCAGACTCTATCATAGAGTCTAAAGTTATTTATTACCTCAAACAATGT
GAACTTAGAGTCTAAATAAGACTTGAAGTCTTATTTTTTTCTACCTCTTTCTTCAATAAATATCCTGCCACATCAGCAAAGTATCATAAATAATATGTAATTAATTGTCTTGGACTCTGT
GATAGAGTCTTGCATTGTGCAGATTCTATCATAGAGTCTAAAGTTATTTATTACCTCGAACAATGTGGACTTAGAGTCTAAATAAGACCTAGGGTCTTATTTTTTCTACCTCTTTCTTCA
ATAATATGCTGCCACATCAGCAAAAAGTCATAAATAATATGTAATTAATTGTCTTGGACTCTGTGATAGAGTCTTGCATTGTGAGTGCCCTTAGTGTGTTGCAAAATGAACTATTATTAG
AGAGAGCAGGTAGCTTAGGGCACTCACAATGCAGACTCTATCATAGAGTCTAAAGTTATTTATTACCTCGAATAATGTGGACTTGGAGTCTAAATAAGACTTGAAGTCTTATTTTTTCTA
CCTCTTTCTTCAATAAATATGCTGCCATATCAGCAAAATATCATAAATAATATATAATTAAGTGTCTTGGACTCTGTGATAGAGTCTTGCGTTGTGAGTGCCCTTAGTACCTAATACCTG
TACGTGAGCCGGCCGGCTAGATGGCCAGTTGCAGATCGATCGAAGTCAATGCACACACAAAAAAAAAAAAGGTTTGAATGGTCTCCGTCAGATTCGTCGCTTTGAAAATGCAGTGGCAGA
TGAAACGTACGTGTCACTGTCTCCCCACGTGCGTGGTTGGATTAATGGGCTGCTAAATGCTCACTGTGCGCGGATCAGATGCGTTCCCTGGTCTGGTCGTCGATGTCGGCTAGCAGCAAC
CATCGCCGCCGTGTCATCGTCGATCTTCCTGTTATCCCTTTATTATCTGTTAACTAATACTCAATCCATCCCAAATTGTAAGTCGTTTGACTTTTTTAATAACAAGTTTGACCACTCGTC
TTATTCAAAGTTTTGTACAAAATATCATTTTTTTTTGTTGTGTATTGGTTTATTAATAAAAGTTCTTCAAGAATGACTTAAAATTTGACTATATTTGCACAAATTTTTTGAATAAGACGA
GTGGTCAAACTTGAGGTTAAAAAAGTCAAACGACTTACAATTTGGGATGGAGGGAGTATAAATTAGCTAGTGTGTAATGGTCAGAGTTGGTTGTTAATAACTAATACATTTGATCATGAT
CATCTAGCTAGCTCATCATATGCATGCAGGGTGGCGGTCCGGCGTACAAGGTTCCACTAGGCCGGCGAGACGGCCTAGCAGCGGCGTCGAACGCCGCCGTCCTGGCGGCGCTCCCGTCGC
CGACGTCGACGGTGCCAACACTGCTCTCCTTCCTGTCGAAGATCAACCTGGACGTGACGGACCTGGTGGCGCTGTCCGGCGGCCACACGGTGGGCGTCGCGCACTGCAGCTCCTTCAGCA
ACCGTCTGTTCCCGACGCAGGACCCGACGCTGAACAAGTTCTTCGCGGGGCAGCTGTACGGGACGTGCCCGACCGACACCACGGTGAACACGACGGTGAACGACATCCGGACGCCCAACA
CGTTCGACAACAAGTACTACGTGGACCTGCTGAACCGGCAGGGCCTCTTCACGTCGGACCAGGACCTGCTCACCAACGCTACGACCAGGCCTATCGTCACCAAGTTCGCTGTTGACCAGA
ACGCCTTCTTCGAGCAGTTCGTCTACTCGTACGTCAAGATGGGGCAGATCAATGTGCTCACGGGGTCCCAGGGACAGGTTCGCGCCAACTGCTCCGCGCGCAACGCTGGTGCTGCAGGTA
ACGGTGGCGAGGACCAGCTGCCGTGGTCCGACGTCGTCGAGACCGTCGTCGACGCCACCGGCAGCCTCGTGCTCTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGGCTACTACTACTTCTCGTCCTGCCGCTGCTGCTCTGCCGCTGGCGGTACTGGCAGCAGCCATGGTGGTGGCCCTGGCGGCGGCCGGCGACGTCGTCGAGCAGCAGCTCGAGGTC
GTTGGCAGCAGGTACCCGCCGCTGGCGCCGGGCCTGTCGTTCGACTTCTACAAGAAGAGCTGCCCGAAGGCGGAGTCGATCGTGAAGGAGTTCCTGTCGTCGGCGGTGCGGCAGAACGTG
GGGCTCGCCGCCGCGCTGATCCGGGTCCACTTCCACGACTGCTTCGTGCAGGGCTGCGACGCCTCCGTCCTGCTCGACTCCACGCCCACCCAGCCCAGCGAGCAGCTGTCGCCGCCCAAC
CTTACGCTTCGGCCGGCGGCGTTCAAGGCCATCAACGACATCCGCGCCCGCCTCGAGCAGGCCTGCGGCCGCGTCGTCTCCTGCGCCGACATCACCGCCCTCGCCGCCCGTGAATCCGTT
GCCCTG
GGTGGCGGTCCGGCGTACAAGGTTCCACTAGGCCGGCGAGACGGCCTAGCAGCGGCGTCGAACGCCGCCGTCCTGGCGGCGCTCCCGTCGCCGACGTCGACGGTGCCAACACTG
CTCTCCTTCCTGTCGAAGATCAACCTGGACGTGACGGACCTGGTGGCGCTGTCCGGCGGCCACACGGTGGGCGTCGCGCACTGCAGCTCCTTCAGCAACCGTCTGTTCCCGACGCAGGAC
CCGACGCTGAACAAGTTCTTCGCGGGGCAGCTGTACGGGACGTGCCCGACCGACACCACGGTGAACACGACGGTGAACGACATCCGGACGCCCAACACGTTCGACAACAAGTACTACGTG
GACCTGCTGAACCGGCAGGGCCTCTTCACGTCGGACCAGGACCTGCTCACCAACGCTACGACCAGGCCTATCGTCACCAAGTTCGCTGTTGACCAGAACGCCTTCTTCGAGCAGTTCGTC
TACTCGTACGTCAAGATGGGGCAGATCAATGTGCTCACGGGGTCCCAGGGACAGGTTCGCGCCAACTGCTCCGCGCGCAACGCTGGTGCTGCAGGTAACGGTGGCGAGGACCAGCTGCCG
TGGTCCGACGTCGTCGAGACCGTCGTCGACGCCACCGGCAGCCTCGTGCTCTAG

Retrieve as FASTA