Entry information : EgrPrx54 (Eucgr.A02460 / Egrandis_v1_0.018837m)
Entry ID 8014
Creation 2011-02-09 (Qiang Li)
Last sequence changes 2011-02-10 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2013-10-30 (Qiang Li)
Peroxidase information: EgrPrx54 (Eucgr.A02460 / Egrandis_v1_0.018837m)
Name (synonym) EgrPrx54 (Eucgr.A02460 / Egrandis_v1_0.018837m)
Class Class III peroxidase    [Orthogroup: Prx065]
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus grandis    [TaxId: 71139 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EgrPrx54
start..stop
S start..stop
EglPrx54 677 0 1..333 1..333
EguPrx51 677 0 1..334 1..334
EgrPrx53 677 0 1..334 1..334
EglPrx53 676 0 1..334 1..334
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 35263534..35263761 228 N° 2 35263894..35264085 192 N° 3 35264212..35264377 166 N° 4 35265789..35266207 419
join(35263534..35263761,35263894..35264085,35264212..35264377,35265789..35266207 )


exon

Literature and cross-references EgrPrx54 (Eucgr.A02460 / Egrandis_v1_0.018837m)
DNA ref. Phytozome 12:   scaffold_1 (35263534..35266207)
Protein sequence: EgrPrx54 (Eucgr.A02460 / Egrandis_v1_0.018837m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   335 (305)
PWM (Da):   %s   36158.09 (33097.4) Transmb domain:   %s   i7-29o
PI (pH):   %s   6.3 (5.59) Peptide Signal:   %s   cut: 30 range:30-334
Sequence 376
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAHSSTLSSPTVVALFAAALLFLLHPLNAELTADFYAKTCPDVSSIVQTVIHEALQYDPRITASLLRLHFHDCFVQGCDGSVLLDNSPTIKSEKDAAPNFNSARGFGVVDKIKAAIESTCPETVSCADILALAANASVYLSGGPYWTVLLGRRDSLTANQGLANVSIPSPFDSYANLTSKFYVLGLDITDLVTLSGAHTFGRAHCKSFTPRLYNFTKNGGPDPTLSPWYLTALQKLCPPNFNPKVITDLDPTTPNLFDNHYYSNLQKNDGLFETDQELYSTADAATVPIVNSFSADQSAFFKSFTRSIVNMGNISPLTGSNGEIRCNCRKVNKS*

Retrieve as FASTA  
Remarks Complete sequence from genomic (scaffold_1:35,263,534..35,266,207, Egrandis_v1_0.018837m). Correct prediction from phytozome.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGGCCCATTCTTCTACTCTTTCGTCGCCAACGGTGGTGGCCCTTTTTGCCGCCGCCTTGTTGTTTCTCCTCCATCCATTGAATGCTGAACTAACCGCTGATTTTTATGCAAAGACATGCC
CGGACGTGTCCAGCATCGTCCAGACCGTGATTCATGAGGCCCTTCAATATGACCCACGCATCACCGCCAGCCTCCTCCGTCTCCATTTTCACGATTGCTTCGTCCAA
GTGAGTCCCTACA
CTAGATCAATTCCCATTGACAATGAGTTCCAACTTGCCGCATTCTTTTTACAGTACTTTCGATCTGATTATTGAGTTATTAGTCACGTAACCTAATGCTTGAGCATGACGTGTTTAAAGG
GGTGTGATGGATCGGTATTGCTGGACAATAGCCCAACCATAAAGAGCGAGAAAGATGCTGCTCCGAATTTTAATTCCGCAAGAGGGTTCGGTGTGGTGGACAAGATCAAAGCGGCTATTG
AGAGCACTTGTCCTGAGACTGTGTCTTGCGCTGACATCCTCGCCCTGGCTGCTAACGCTTCCGTTTATTTG
GTATATGTCGTTTTAGTCAAAGAAACATAAAACATATTTAAAGTATACT
TAGGATTCGTTATTGTCACTTGGCCTACACGAATTATAATTGTGTTTCTCTTGATTATCACTTTTATGAAATTGCAGTCAGGAGGTCCATATTGGACGGTGCTCTTGGGGAGGAGGGACA
GCTTGACGGCGAACCAAGGGCTAGCGAACGTATCGATCCCCTCCCCTTTTGATAGCTATGCCAACCTCACTTCCAAGTTCTATGTTTTGGGCTTGGACATCACCGACCTTGTCACACTTT
CCG
GTAAAATAGAACAGTTGGACTTGCATTTTGATACGAACATGCAACTACAGATATTGATGCACAAAATAGATTAACAGAGTGAAATGTAATATTTTTGTCACATAACTTATTGGCACA
AACATCGCATCACTTTCATTTAGCACATTTCAACTTCCTAATATGATCAAGGTCTCTTCTTCATTGAGATCAACAGACAGGCATGGGCTGTGCATGTGCATGGGCCATGCCCCGGCGATG
CTATCTACTAGAAGGAATTTTAGTTAAGGATTAAGGGTTAATTTTTTTTAATCTAAAATTGAATTTAAGTAAAGAATCGTCCTAAAACATGAGATCGACTAAAGTGCATGTGTTGTGCCT
AGGCTGTACCTGGGTCGTGCATGGGCTATGCACATTTACTAGAAGGAATTTTGGCTGAGGATTAATGATTTCTTTTTTACCAAAAATTGAAAAAGTAGAGGATTGCCTATGACTTGAGAT
CGACTGACGTGCGTGCGTTGTGCCTAGACCATGCGATGTTGTGCATGGGTATGTACATATATTAGAAGGATTTTTGGCTAAAGGATTGAGGGTTTCTTTCAATCTAAAATTGAATAAGTA
AAGGATTGCCTTCGACTTAATTTCAGGAGCAGTTGTGTATCATCACTACTCTAAAAAAGATAGATTATTTTAAAACAATTTTTTAATTATTTTTTTATTAAATAAAATAGTAAAAGAAAA
TATTTATTGGGGGTAGGTATTATATAAATTAAATGGGCCAAGCAGGAATTTTAGGATGGATCCACGCAAGGGGATTTTAACTTTACTTTTCAGTTCAATCAAACTAACCCTATATGAATT
ACCATTTAATTCAAATGGATCTAAATCAAGCCCGTATCAGCAACTCTTTAAGTCATATCTAGTATAACTTCTGCTATCAAGACGAAGAAGTGGTCAATGATGACACTTCATCGTTCAATT
CATGATGAGGTTCATAGCGTTGAAACCATCGAATTAATGTAATATTTTCTTTGTTGTGATTTGTTTTCAATCAAACTAGTGTACTTTTATGTGTAATTTTTTTTATTACAAATTTGAAAA
ATATATTCGTGTTCAATGGGTAATTTTATATTCCTAATATCATTACAAGAGTATAAATATTGGAGGAGGATGCTATCAAAATTTGCAAGCCCCTCACATACTTGTATGAGAAATGCCAAG
TATACTGAGGTCATTTGATAGAATCAATAAAATAAGTGATGTCACATATCGCTATTATTTATTTATATTTTTACTAACGAGTTTGTTGCATATGTTTAGTATACAAATTCTATTAAGCAT
TCCTAGTATTGGTCTATTTATCCACCTTCACAATTGAGCTCTGCAGATATTTTGTTCTCTTAGCTAATTATTCGTGCATATGATAATAAAACAGGAGCTCACACCTTCGGACGTGCACAT
TGCAAGTCATTCACCCCTAGGCTGTACAACTTCACCAAAAATGGCGGCCCCGATCCCACCCTAAGCCCGTGGTACTTGACGGCTCTCCAGAAACTTTGCCCTCCAAACTTCAATCCTAAA
GTCATCACCGACCTCGATCCGACGACCCCGAACTTGTTTGACAACCACTACTACTCCAACCTCCAGAAAAATGACGGGCTTTTTGAGACTGATCAAGAGCTGTACTCGACAGCCGATGCT
GCGACAGTACCCATCGTCAACAGCTTCAGTGCCGACCAGAGTGCCTTCTTCAAGAGCTTCACTCGGTCGATAGTAAACATGGGAAACATAAGTCCTCTCACCGGAAGTAACGGGGAGATC
AGGTGCAATTGCAGGAAGGTCAATAAGAGTTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGGCCCATTCTTCTACTCTTTCGTCGCCAACGGTGGTGGCCCTTTTTGCCGCCGCCTTGTTGTTTCTCCTCCATCCATTGAATGCTGAACTAACCGCTGATTTTTATGCAAAGACATGCC
CGGACGTGTCCAGCATCGTCCAGACCGTGATTCATGAGGCCCTTCAATATGACCCACGCATCACCGCCAGCCTCCTCCGTCTCCATTTTCACGATTGCTTCGTCCAA
GGGTGTGATGGAT
CGGTATTGCTGGACAATAGCCCAACCATAAAGAGCGAGAAAGATGCTGCTCCGAATTTTAATTCCGCAAGAGGGTTCGGTGTGGTGGACAAGATCAAAGCGGCTATTGAGAGCACTTGTC
CTGAGACTGTGTCTTGCGCTGACATCCTCGCCCTGGCTGCTAACGCTTCCGTTTATTTG
TCAGGAGGTCCATATTGGACGGTGCTCTTGGGGAGGAGGGACAGCTTGACGGCGAACCAAG
GGCTAGCGAACGTATCGATCCCCTCCCCTTTTGATAGCTATGCCAACCTCACTTCCAAGTTCTATGTTTTGGGCTTGGACATCACCGACCTTGTCACACTTTCCG
GAGCTCACACCTTCG
GACGTGCACATTGCAAGTCATTCACCCCTAGGCTGTACAACTTCACCAAAAATGGCGGCCCCGATCCCACCCTAAGCCCGTGGTACTTGACGGCTCTCCAGAAACTTTGCCCTCCAAACT
TCAATCCTAAAGTCATCACCGACCTCGATCCGACGACCCCGAACTTGTTTGACAACCACTACTACTCCAACCTCCAGAAAAATGACGGGCTTTTTGAGACTGATCAAGAGCTGTACTCGA
CAGCCGATGCTGCGACAGTACCCATCGTCAACAGCTTCAGTGCCGACCAGAGTGCCTTCTTCAAGAGCTTCACTCGGTCGATAGTAAACATGGGAAACATAAGTCCTCTCACCGGAAGTA
ACGGGGAGATCAGGTGCAATTGCAGGAAGGTCAATAAGAGTTGA

Retrieve as FASTA