Entry information : EgrPrx97 ( Eucgr.F04198 / Egrandis_v1_0.017837m)
Entry ID 8020
Creation 2011-02-04 (Christophe Dunand)
Last sequence changes 2011-02-04 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2016-04-11 (Christophe Dunand)
Peroxidase information: EgrPrx97 ( Eucgr.F04198 / Egrandis_v1_0.017837m)
Name (synonym) EgrPrx97 ( Eucgr.F04198 / Egrandis_v1_0.017837m)
Class Class III peroxidase    [Orthogroup: Prx004]
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus grandis    [TaxId: 71139 ]
Cellular localisation N/D
Tissue type Xylem
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EgrPrx97
start..stop
S start..stop
EglPrx97 720 0 1..350 1..350
EcamPrx97 710 0 1..350 1..350
EguPrx97 679 0 1..350 1..350
EcamPrx96 639 0 1..350 1..350
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 50216662..50216895 234 N° 2 50215720..50215914 195 N° 3 50213763..50214386 624  
complement(join(50213763..50214386,50215720..50215914,50216662..50216895))


exon

Literature and cross-references EgrPrx97 ( Eucgr.F04198 / Egrandis_v1_0.017837m)
Literature REFERENCE 1 Qiu,D., Wilson,I., Gan,S., Washusen,R., Moran,G. and Southerton,S. Gene expression in Eucalyptus branch xylem deficient in G-layer enriched tension wood.
REFERENCE 2 Kirst,M., Myburg,A.A., De Leon,J.P., Kirst,M.E., Scott,J. and Sederoff,R. Coordinated genetic regulation of growth and lignin revealed by quantitative trait locus analysis of cDNA microarray data in an interspecific backcross of eucalyptus. Plant Physiol. 135 (4), 2368-2378 (2004).
DNA ref. Phytozome 12:   scaffold_6 (50216895..50213763)
EST ref. GenBank:   EW688459.1 [Fragment]
Protein sequence: EgrPrx97 ( Eucgr.F04198 / Egrandis_v1_0.017837m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   351 (324)
PWM (Da):   %s   38429.31 (35608.8)  
PI (pH):   %s   5.02 (4.84) Peptide Signal:   %s   cut: 27 range:27-350
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASRFSSFVLISCLVIASSPVHVSSSAHLVKGLSWSFYEKSCPKVESVIRKHLKKVFEKDIGQAAGLLRVHFHDCFVKGCDGSVLLDGSANEPSEQDAPPNRSLRRTAFKIIDDLSQLVEKKCGQVVSCADIAAIAARDSVFLSGGPEYDVPLGRRDGLTPATENVVIENIPAPTENASEILSALAKKNFDATDVVALSGGHTIGLAHCTAFENRLYPTQDPTMEKTFAHDLKGVCPTTNSTNTTVLDIRSPNRFDNKYFVDLMNRQGLFTSDQDLYEDPTTRDIVTSFAEDQELFFEKFVLAMTKMGQLSVLTGTKGEIRANCSVRNSENPDLLKYVVEEDLESYAELK*

Retrieve as FASTA  
Remarks Complete sequence from genomic and 2 ESTs (CB967573.1).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCTCCCGCTTCAGCTCTTTCGTTTTGATTTCTTGTCTCGTGATAGCTTCGTCGCCTGTTCATGTCTCGAGCTCTGCTCACTTAGTGAAGGGGCTCTCGTGGTCCTTCTACGAGAAA
AGCTGTCCCAAGGTTGAGTCCGTCATCAGGAAACATCTCAAGAAGGTGTTTGAGAAGGACATTGGCCAAGCTGCCGGGCTACTTCGTGTGCACTTCCATGACTGCTTTGTTAAG
GTAGGT
ACCCAAGGAGCTCTGTCACAATCTGCATTCACTATACCGGGCAAAGTGATTTGGGATTTACTTGAAAGTTGTATCTTGATTTGCTCGTCACATGTCCTTGTATATGGTGGTCAGCTGATG
TTAAAATGTTTACACACCCTTTTGGCAAGATCTGTGATCATCTTCTTCCCCAGCAAAATAGACGAGAATAAGAAAAGACGGAGAGGCCAAAGAAAAAAAAAAGTTCTTGTCGAGTTGGTG
GCCTAGGTTAGCAGCTGCAATAAGTGAACTTCTTTCCTTTTGATATTGCTAATTTTTAGAATGCTGGGTAGATTACGAAGTCATACGGGTGCCTAAAGCCATCACGACTTTGTCTTTTAG
CATACTAATATTACTGTCTTACTAGTAAACACTTGCTGAAGTTTTGGAGGATGCTTTTTGAGCGTTTGACATAGTTGATCCTGATCTTTAGTGCTTTATATGCTAAAATGAAGAGCATAG
AAGTTCATAGAACTCCCGTGTTCAGGTTTTAGACAGAACTGCTGTAATAATTCTGGTAAATTGTCTTCATAAGATGATTGTACGAGCAGTCCAGTTAAGCCCGGATTGTGTGTGGCGAGG
ATTTTTTTGCTTTGAAGGTTAGGATGGGTTTAAGTCATCGCGGTTTCTTTTACAATTGAATCTTGATCACTTACATTAAAATAAATGATAAAACATTCTTTGAATTCACGATTATTTTTT
AAGATCTGATGAGTGATGCAGGGATGCGATGGTTCGGTGTTGCTGGATGGATCGGCAAATGAACCGAGCGAGCAGGACGCTCCACCAAACAGGAGCTTGAGACGGACAGCATTCAAGATC
ATTGATGACCTCAGTCAGCTCGTGGAGAAGAAATGTGGTCAAGTAGTCTCTTGTGCCGACATCGCCGCCATTGCCGCTCGTGATTCCGTTTTCCTG
GTAAACCCCCTTCAGCCATCATTC
CATCATCACTAGAGAGTAACGCACCAAAACAGAGTTCTGATTATGATACTCGCCAGATTCTGATTATCATACTATCGGAAATTTGATAGAAGTACAGATTCTTGCCGAACATGCTTATCC
CTATAAATCATACTAATTTGCAGCTTTGAATGATGCTTTTGCATTTGGTAATGGGAAGGCAAATATGATCATAAGCTTTCAAAATAGAGCAACAGCAGAATACAGTATTGGTCAGTTAGC
TAGCTTCCTAGATAATTGTAATAGTTCTTATGTTCAAGTTGATAAATGGATTTCTATTTAGGGATTAATTGGATTATCGAACTAACCAAACATATAGTAAGTTACACGTTCACACAGAAC
TTTCACTGATTGGATGTTCCCCCTCCGTTAAACATTCAACCACTCCCCATTAATCTGCTGTTTTTGGAAATCAAGTTGATGTATAAAATACCCCAAACCTAACAGAATGTGGACCTTCGC
AAGATGGTACTGGAACTTTGATCTCGTCATGTGGCCATGTGACAGACAATAGTTGTTTAACCACTCTTGTTTAGGCTCAGGCTTGATTATACTCATTAGTTATGATGATAATTATACTTT
ATCGCTCTCTCAATGGTAATGTTCGATGATGCTTGGTAAGAGGAATTATAAATCACGAGAAAGTGGACTCGCTGATGTAACCAAGCGTGGTTAAACTATATTTGGATTCTTGTAGTTTCC
TCCTGTTCGTGTTCTGAATGTTTTGTGAGATGTAGCGGATGTCCATTTAAGTCGGCAGCATTATCTTGGAAACTCAGGACAATTAAACCTGTCATTATGAGCCAAAAAGTTCAGTATACA
GCAAATTTCAATGGTCAAAACTGAGACATCGTCGTTGTTTATATCTGAGTTTTAACCGGTAGTTATCACCATTTTTTTAAGATCCCAACCAGTCGGAGGTTTATTCTGAATTTTGGGATC
ATGATTATGGATAAAATACTGCAACTTGACATGTCTTTGGACTCTTTCAACATGGTCAGGTAAGCATGTGCTTCCAAAGTTCTTGGAAATTGCAGTTGAAATGACAACCTAGGTAGACGA
TTCTGTTTAATGATAATCTACTCCCAACTAGCTTCTAGTTTATGAGAGTTGACTTGCAAATGATCACCTCCACACGAAGAAGACATCAAAGTTCTCCGCTGGCTTCATGTCCTATACATG
ATCGAAGTTTTCTCGATTATGATTACTATTGCCCATCATATCAATGAGCATCAACAGATGCTTTCCAAGTTCTGGATTCTAATTCTGTTATTCTCGTCGTCGTGTGCAGTCGGGCGGACC
TGAGTATGATGTGCCGTTGGGAAGGCGGGATGGACTTACGCCTGCGACTGAAAATGTGGTCATAGAGAATATACCTGCACCAACTGAGAACGCCAGTGAAATTCTCTCCGCCCTAGCCAA
GAAAAACTTCGACGCTACCGACGTAGTGGCCCTCTCTGGAGGCCACACCATTGGGCTTGCGCACTGCACCGCCTTTGAGAATCGGCTCTACCCGACCCAAGACCCCACCATGGAGAAGAC
CTTTGCCCATGATCTCAAGGGCGTGTGCCCCACCACAAACTCCACCAACACTACGGTCTTGGACATCCGATCACCCAACCGATTCGACAACAAGTACTTTGTCGATTTGATGAACCGCCA
AGGCCTGTTCACCTCAGACCAAGATCTGTATGAGGATCCCACAACGAGGGACATCGTCACTAGCTTCGCCGAGGACCAGGAATTGTTCTTCGAGAAGTTTGTCCTAGCTATGACGAAAAT
GGGACAACTCAGTGTGTTGACAGGGACGAAAGGAGAAATCCGAGCCAACTGCTCGGTCAGGAATTCTGAGAACCCCGATCTCTTGAAGTACGTGGTGGAAGAGGACCTGGAGAGCTATGC
TGAATTGAAATGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCTCCCGCTTCAGCTCTTTCGTTTTGATTTCTTGTCTCGTGATAGCTTCGTCGCCTGTTCATGTCTCGAGCTCTGCTCACTTAGTGAAGGGGCTCTCGTGGTCCTTCTACGAGAAA
AGCTGTCCCAAGGTTGAGTCCGTCATCAGGAAACATCTCAAGAAGGTGTTTGAGAAGGACATTGGCCAAGCTGCCGGGCTACTTCGTGTGCACTTCCATGACTGCTTTGTTAAG
GGATGC
GATGGTTCGGTGTTGCTGGATGGATCGGCAAATGAACCGAGCGAGCAGGACGCTCCACCAAACAGGAGCTTGAGACGGACAGCATTCAAGATCATTGATGACCTCAGTCAGCTCGTGGAG
AAGAAATGTGGTCAAGTAGTCTCTTGTGCCGACATCGCCGCCATTGCCGCTCGTGATTCCGTTTTCCTG
TCGGGCGGACCTGAGTATGATGTGCCGTTGGGAAGGCGGGATGGACTTACG
CCTGCGACTGAAAATGTGGTCATAGAGAATATACCTGCACCAACTGAGAACGCCAGTGAAATTCTCTCCGCCCTAGCCAAGAAAAACTTCGACGCTACCGACGTAGTGGCCCTCTCTGGA
GGCCACACCATTGGGCTTGCGCACTGCACCGCCTTTGAGAATCGGCTCTACCCGACCCAAGACCCCACCATGGAGAAGACCTTTGCCCATGATCTCAAGGGCGTGTGCCCCACCACAAAC
TCCACCAACACTACGGTCTTGGACATCCGATCACCCAACCGATTCGACAACAAGTACTTTGTCGATTTGATGAACCGCCAAGGCCTGTTCACCTCAGACCAAGATCTGTATGAGGATCCC
ACAACGAGGGACATCGTCACTAGCTTCGCCGAGGACCAGGAATTGTTCTTCGAGAAGTTTGTCCTAGCTATGACGAAAATGGGACAACTCAGTGTGTTGACAGGGACGAAAGGAGAAATC
CGAGCCAACTGCTCGGTCAGGAATTCTGAGAACCCCGATCTCTTGAAGTACGTGGTGGAAGAGGACCTGGAGAGCTATGCTGAATTGAAATGA

Retrieve as FASTA