Entry information : EgrPrx91(Eucgr.F01472 / Egrandis_v1_0.046972m)
Entry ID 8022
Creation 2011-02-04 (Christophe Dunand)
Last sequence changes 2011-02-15 (Catherine )
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2022-03-28 (Catherine )
Peroxidase information: EgrPrx91(Eucgr.F01472 / Egrandis_v1_0.046972m)
Name EgrPrx91(Eucgr.F01472 / Egrandis_v1_0.046972m)
Class Class III peroxidase    [Orthogroup: Prx022]
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus grandis    [TaxId: 71139 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EgrPrx91
start..stop
S start..stop
EglPrx91 810 0 1..399 1..399
EcamPrx91 808 0 1..399 1..399
EguPrx91 801 0 1..399 1..399
PpePrx50 479 2e-170 66..395 8..344
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 18952970..18953311 342 N° 2 18952679..18952876 198 N° 3 18952171..18952336 166 N° 4 18951572..18952065 494
complement(join(18951572..18952065,18952171..18952336,18952679..18952876,1895297 0..18953311))


exon

Literature and cross-references EgrPrx91(Eucgr.F01472 / Egrandis_v1_0.046972m)
DNA ref. Phytozome 12:   scaffold_6 (18953311..18950840)
Cluster/Prediction ref. JGI gene:   104451628
Protein sequence: EgrPrx91(Eucgr.F01472 / Egrandis_v1_0.046972m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   399 (381)
PWM (Da):   %s   43916.73 (41887.6) Transmb domain:   %s   i5-22o
PI (pH):   %s   5.6 (5.41) Peptide Signal:   %s   cut: 22 range:22-402
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MPNSLNGWIVIFVLLVSFLASFRNRKGSSADQRGRPFDPPFSLHPLSPVLLQRNDDGAAVDDEDPALGLQYDFYRNTCPAAEEIVRSSMSRIYSQHPDVAPAFLRLLFHDCFIRGCDASVLLDDSHGNRSHPIERQAIPNRTLKGFDRIDTIKQELEDHCPGVVSCADVLVLATREGILLAGGPFYPLFTGRRDSIQSYYADAMAEIPKPDDNVFRTLHLFGLRGFDERETVSLLGGHNIGKIGCEFILERLHNFLGTGQPDPTISADFLSEMRRNCGDSQTSSNSSSGSPLLMESTSLTKSDLGLTYFPQLATSISSGSSFDTHYYQSLLRGRGLLYADQQLMADERTASVVRAYASDDGSAFRLDFARAMMKMSSLGILSGSDGQIRKNCSFVANGN*

Retrieve as FASTA  
Remarks Complete sequence from genomic. Incorrect prediction from phytozome (a part of exon 1 is missing which has been completed).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCCCAACTCCCTGAACGGCTGGATCGTCATCTTCGTCCTCCTCGTCTCCTTCCTCGCCTCCTTCAGGAACCGCAAGGGCTCGAGCGCCGACCAGCGTGGGCGGCCCTTCGACCCTCCC
TTCTCTCTCCACCCCCTCTCGCCCGTCCTTCTCCAGCGGAACGACGACGGCGCCGCCGTCGACGATGAAGACCCCGCGCTCGGGCTCCAGTACGACTTCTACCGCAACACCTGCCCTGCT
GCGGAAGAAATCGTGAGGTCTTCCATGTCCAGGATCTACTCCCAACACCCCGACGTCGCCCCCGCGTTTCTCCGTCTCCTCTTCCACGACTGCTTCATCAGG
GTTCCTCCTCCTCCTCCT
TCTTCGTCTCTGCTTTGTGGGGTTCCTCGTTTAGGGGCTGATTGCCATTGGGTTTGGGTTATTTTCTCGAGTCAGGGTTGCGATGCTTCAGTTCTCCTGGACGATAGCCATGGAAACCGC
AGCCACCCCATCGAAAGGCAGGCCATCCCCAACCGGACCCTCAAGGGTTTCGACAGGATCGATACCATCAAGCAGGAGCTTGAAGATCATTGCCCTGGGGTTGTTTCTTGTGCCGATGTT
CTCGTGCTCGCCACCCGGGAGGGCATCCTCCTG
GTACGCTCTTCTCTCGTTCCCCTCTTCCAATTTCAAGAAACTGTCCCGTCCCCTGTCATCGCCGTCCGTTCATGTGGATTTCGATGA
AATTTAGTATTCTCATATTGGCATTGAATTGGCGCTCTATGTGGAAAAGTTTAATAATGATTCTCGAAGTCAGCATGGCATTTGGGAAGATTTCATCTACTCCACGTCTAGGAACTTCTT
TCCTCTGTGTTTCCAGGCTTGCAGCTGGACGACAGCTACTTGATTAGTTTGTTCGAGCTTCTTAAGAATCTCTGTTTCTGTTTCCTTTTAACTCCTTATCCTATTCACCTCGTCTTTTGA
TGTTCGAGTCCACAGGCTGGTGGCCCATTCTATCCCCTTTTCACCGGCAGGAGAGACAGTATTCAGTCCTATTATGCAGATGCAATGGCTGAAATTCCTAAGCCCGACGATAATGTCTTC
CGGACGCTCCACCTGTTCGGTCTCAGAGGTTTTGACGAGAGAGAAACAGTCAGTCTCTTAG
GTATTATCACTAAAGTCCATCCTTCTATCTTACTTTGTGGTCGAGTTTGTTTGAACTGT
GAGTGGATAACCAGGCACTGAATTGATTAATTATGTTGATATGAAGGAGGTCACAATATCGGCAAGATCGGTTGTGAGTTCATCTTAGAACGCTTGCACAATTTCTTAGGGACAGGTCAG
CCAGACCCAACCATATCTGCAGATTTTCTTAGTGAGATGAGACGCAACTGTGGAGACAGTCAGACCAGCAGCAATAGCAGCAGTGGCTCTCCACTGCTCATGGAATCAACGAGCCTTACT
AAGTCTGATTTGGGTTTGACATACTTCCCACAGTTAGCGACTTCAATTTCTTCCGGATCAAGCTTTGACACCCATTATTACCAGAGCTTGCTTAGAGGGAGAGGTCTTCTATATGCTGAT
CAGCAGTTAATGGCTGACGAGAGAACTGCAAGTGTCGTAAGGGCTTATGCCTCAGATGACGGATCAGCCTTCAGATTGGACTTTGCTCGTGCTATGATGAAAATGTCAAGTCTTGGTATA
TTGTCTGGATCAGATGGGCAGATCCGAAAAAATTGCTCGTTTGTCGCCAACGGCAATTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCCCAACTCCCTGAACGGCTGGATCGTCATCTTCGTCCTCCTCGTCTCCTTCCTCGCCTCCTTCAGGAACCGCAAGGGCTCGAGCGCCGACCAGCGTGGGCGGCCCTTCGACCCTCCC
TTCTCTCTCCACCCCCTCTCGCCCGTCCTTCTCCAGCGGAACGACGACGGCGCCGCCGTCGACGATGAAGACCCCGCGCTCGGGCTCCAGTACGACTTCTACCGCAACACCTGCCCTGCT
GCGGAAGAAATCGTGAGGTCTTCCATGTCCAGGATCTACTCCCAACACCCCGACGTCGCCCCCGCGTTTCTCCGTCTCCTCTTCCACGACTGCTTCATCAGG
GGTTGCGATGCTTCAGTT
CTCCTGGACGATAGCCATGGAAACCGCAGCCACCCCATCGAAAGGCAGGCCATCCCCAACCGGACCCTCAAGGGTTTCGACAGGATCGATACCATCAAGCAGGAGCTTGAAGATCATTGC
CCTGGGGTTGTTTCTTGTGCCGATGTTCTCGTGCTCGCCACCCGGGAGGGCATCCTCCTG
GCTGGTGGCCCATTCTATCCCCTTTTCACCGGCAGGAGAGACAGTATTCAGTCCTATTAT
GCAGATGCAATGGCTGAAATTCCTAAGCCCGACGATAATGTCTTCCGGACGCTCCACCTGTTCGGTCTCAGAGGTTTTGACGAGAGAGAAACAGTCAGTCTCTTAG
GAGGTCACAATATC
GGCAAGATCGGTTGTGAGTTCATCTTAGAACGCTTGCACAATTTCTTAGGGACAGGTCAGCCAGACCCAACCATATCTGCAGATTTTCTTAGTGAGATGAGACGCAACTGTGGAGACAGT
CAGACCAGCAGCAATAGCAGCAGTGGCTCTCCACTGCTCATGGAATCAACGAGCCTTACTAAGTCTGATTTGGGTTTGACATACTTCCCACAGTTAGCGACTTCAATTTCTTCCGGATCA
AGCTTTGACACCCATTATTACCAGAGCTTGCTTAGAGGGAGAGGTCTTCTATATGCTGATCAGCAGTTAATGGCTGACGAGAGAACTGCAAGTGTCGTAAGGGCTTATGCCTCAGATGAC
GGATCAGCCTTCAGATTGGACTTTGCTCGTGCTATGATGAAAATGTCAAGTCTTGGTATATTGTCTGGATCAGATGGGCAGATCCGAAAAAATTGCTCGTTTGTCGCCAACGGCAATTGA

Retrieve as FASTA