Entry information : EgrPrx95 (Eucgr.F03724 / Egrandis_v1_0.019864m)
Entry ID 8027
Creation 2011-02-04 (Christophe Dunand)
Last sequence changes 2011-02-08 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2013-10-30 (Qiang Li)
Peroxidase information: EgrPrx95 (Eucgr.F03724 / Egrandis_v1_0.019864m)
Name (synonym) EgrPrx95 (Eucgr.F03724 / Egrandis_v1_0.019864m)
Class Class III peroxidase    [Orthogroup: Prx017]
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus grandis    [TaxId: 71139 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EgrPrx95
start..stop
S start..stop
EguPrx95 654 0 1..318 1..318
EcamPrx95 653 0 1..318 1..318
EglPrx95 653 0 1..318 1..318
MePrx114 518 0 17..317 19..319
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 45417352..45417558 207 N° 2 45417772..45417960 189 N° 3 45418109..45418271 163 N° 4 45418470..45418867 398
join(45417352..45417558,45417772..45417960,45418109..45418271,45418470..45418867 )


exon

Literature and cross-references EgrPrx95 (Eucgr.F03724 / Egrandis_v1_0.019864m)
DNA ref. Phytozome 12:   scaffold_6 (45417352..45418867)
Protein sequence: EgrPrx95 (Eucgr.F03724 / Egrandis_v1_0.019864m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   319 (296)
PWM (Da):   %s   34288.46 (32018.2) Transmb domain:   %s   i7-29o
PI (pH):   %s   8.39 (8.22) Peptide Signal:   %s   cut: 23 range:23-318
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MRALAVVLGSAILLAYVASSAGALSLDYYDQTCPKLEYSVRGAVKKAMKNDNTVPAALLRMHFHDCFIRGCDGSVLLNSTAKNTAEKDGPPNISLHAFYVIDLAKEAVEAQCPGVVSCADILALAARDAVALSGGPHWDVPKGRKDGRISKANDTSQLPAPTFNISQLQQSFSQRGLSMEDLVALSGGHTLGFAHCSSFQNRIHNFNSVDDIDPSLHPSFAAQLRKVCPAHNTVRSAGSTLDPTVTKFDNVYYKMLLQGKSIFTSDQALLTVPKTKALVSKFAESQEEFEKAFVKSMIKMSSLSGGGQEIRLNCRVVR*

Retrieve as FASTA  
Remarks Complete sequence from genomic. Correct prediction from phytozome.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCGAGCACTTGCTGTTGTGCTCGGTTCTGCTATCTTGCTGGCGTATGTCGCGAGCAGTGCGGGTGCGCTGAGCTTGGATTACTATGACCAGACGTGCCCGAAGCTCGAGTATTCGGTG
AGGGGGGCTGTGAAGAAAGCGATGAAGAACGACAACACCGTTCCTGCTGCTTTACTTCGCATGCACTTCCACGACTGCTTCATCAGA
GTAACTACTTGTTAATCCTTCACTCTCTGGTAA
ATTTTTCCATGTGAGGTTGGGCTAGCTGTGTATGTTTTCGGCCTTCGTTAGTTCTCCTACGAAGACAAATGAAAAATGACTGCTTCTATGGAACAACTCGTCTCGACGAGACAAGAGTAA
TTCAAGTTTGAACTTATAAGGCATTCATTAATGGTACTAAAGCTTTGATATTATTTCCAGGGATGTGACGGTTCCGTGCTCTTGAACTCGACGGCAAAGAACACAGCCGAAAAAGACGGG
CCGCCTAACATCTCACTCCACGCATTCTATGTGATCGACCTTGCGAAGGAAGCAGTGGAAGCTCAGTGCCCTGGGGTCGTCTCTTGCGCCGACATCTTGGCCTTGGCTGCTCGGGATGCT
GTCGCTCTG
GTGCTTTATGTTTTCCATATCCACTATAACTTACATTCACCTGCGTGTCATTGACATGTCCCGCAACATACATGGTTAAAAGTCAACTCGCGCTATCTTGCTATAATTCCT
AATAATTCAGCATGGTTTTTCCTGATCTCTGTTGTAGTCTGGAGGACCGCATTGGGATGTGCCGAAAGGAAGAAAAGATGGGAGGATTTCGAAAGCGAATGACACAAGTCAATTACCAGC
TCCGACCTTCAACATCTCTCAACTACAGCAAAGCTTCTCTCAAAGAGGCCTTTCCATGGAAGACTTGGTGGCTCTCTCTG
GTACGAATATTTACAAATTTTCATATGTATACACATGAGC
ACTCCGCATTCATCCCGCGTATGTGCATACGTACGCTGCGGCTTACATAAACTCATGCATTCTTAGAAGTGGTCGAAACATATAAGCCAGTATTCAACGGAAACGCCATCGCATGCCCTT
TCGGGGATTAAGTACTGATATATGCGCCTCTGTTACAGGTGGCCACACCCTCGGTTTCGCCCACTGCTCGTCGTTCCAGAACCGGATCCACAACTTCAACTCTGTGGACGATATCGACCC
GTCGTTGCACCCGTCCTTCGCGGCGCAGCTGCGGAAGGTGTGCCCCGCGCACAACACGGTGAGGAGCGCGGGGTCCACGTTGGATCCCACGGTGACCAAGTTCGACAACGTGTACTACAA
GATGCTGCTCCAAGGGAAGAGCATCTTCACCTCGGATCAGGCGCTGCTCACCGTCCCGAAGACGAAAGCACTGGTCTCCAAGTTCGCCGAGAGCCAGGAGGAGTTCGAGAAGGCCTTCGT
GAAGTCCATGATCAAGATGAGCAGCTTGAGCGGCGGCGGGCAAGAGATTAGGCTGAATTGCAGAGTTGTTCGTTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCGAGCACTTGCTGTTGTGCTCGGTTCTGCTATCTTGCTGGCGTATGTCGCGAGCAGTGCGGGTGCGCTGAGCTTGGATTACTATGACCAGACGTGCCCGAAGCTCGAGTATTCGGTG
AGGGGGGCTGTGAAGAAAGCGATGAAGAACGACAACACCGTTCCTGCTGCTTTACTTCGCATGCACTTCCACGACTGCTTCATCAGA
GGATGTGACGGTTCCGTGCTCTTGAACTCGACG
GCAAAGAACACAGCCGAAAAAGACGGGCCGCCTAACATCTCACTCCACGCATTCTATGTGATCGACCTTGCGAAGGAAGCAGTGGAAGCTCAGTGCCCTGGGGTCGTCTCTTGCGCCGAC
ATCTTGGCCTTGGCTGCTCGGGATGCTGTCGCTCTG
TCTGGAGGACCGCATTGGGATGTGCCGAAAGGAAGAAAAGATGGGAGGATTTCGAAAGCGAATGACACAAGTCAATTACCAGCT
CCGACCTTCAACATCTCTCAACTACAGCAAAGCTTCTCTCAAAGAGGCCTTTCCATGGAAGACTTGGTGGCTCTCTCTG
GTGGCCACACCCTCGGTTTCGCCCACTGCTCGTCGTTCCAG
AACCGGATCCACAACTTCAACTCTGTGGACGATATCGACCCGTCGTTGCACCCGTCCTTCGCGGCGCAGCTGCGGAAGGTGTGCCCCGCGCACAACACGGTGAGGAGCGCGGGGTCCACG
TTGGATCCCACGGTGACCAAGTTCGACAACGTGTACTACAAGATGCTGCTCCAAGGGAAGAGCATCTTCACCTCGGATCAGGCGCTGCTCACCGTCCCGAAGACGAAAGCACTGGTCTCC
AAGTTCGCCGAGAGCCAGGAGGAGTTCGAGAAGGCCTTCGTGAAGTCCATGATCAAGATGAGCAGCTTGAGCGGCGGCGGGCAAGAGATTAGGCTGAATTGCAGAGTTGTTCGTTAA

Retrieve as FASTA