Entry information : EgrPrx76 ( Eucgr.D02157 / Egrandis_v1_0.041836m)
Entry ID 8034
Creation 2011-02-04 (Christophe Dunand)
Last sequence changes 2011-02-08 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2016-01-21 (Christophe Dunand)
Peroxidase information: EgrPrx76 ( Eucgr.D02157 / Egrandis_v1_0.041836m)
Name (synonym) EgrPrx76 ( Eucgr.D02157 / Egrandis_v1_0.041836m)
Class Class III peroxidase    [Orthogroup: Prx042]
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus grandis    [TaxId: 71139 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EgrPrx76
start..stop
S start..stop
EglPrx76 681 0 1..329 1..329
EguPrx76 675 0 1..329 1..329
EcamPrx76 630 0 26..329 1..304
PtPrx83 470 2e-168 18..329 27..338
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 35701146..35701355 210 N° 2 35701646..35701837 192 N° 3 35702031..35702196 166 N° 4 35702626..35703047 422
join(35701146..35701355,35701646..35701837,35702031..35702196,35702626..35703047 )


exon

Literature and cross-references EgrPrx76 ( Eucgr.D02157 / Egrandis_v1_0.041836m)
DNA ref. Phytozome 12:   scaffold_4 (35701146..35703047)
Protein sequence: EgrPrx76 ( Eucgr.D02157 / Egrandis_v1_0.041836m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   322 (310)
PWM (Da):   %s   34412.35 (34640.1)  
PI (pH):   %s   9.36 (4.62) Peptide Signal:   %s   cut: 20 range:20-329
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGVLLSVLLLLSLYGVGTSGGEGALVLGYYQEKCPLLEEIVRHSVERAVYREPRMAASLLRVHFHDCFVMGCDASVLLDSFDGMVSEKQAVPNLNSLRGFEVIDEIKYNLEEACPYTVSCADILAIVARDAVELRGGPRWEVWLGRRDSLKASFDGANKFIPAPNSSLEALIANFGQQGLDERDLVALSGSHTMGKARCLSFRQGIYEESTERQYDPFQRYTTFYDTLQSICPETGSDNRLASLDHVTPFEFDNHYFLNLLQGTGLLPSDNALINEDHEGVISRLVWTYASDTEAFFRDFANSVVKMGNINVLTESGGEIRRTCRFINT*

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns). Correct prediction from phytozome.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGGGTATTATTGAGTGTGTTGCTACTTTTGAGTTTGTACGGAGTGGGCACTTCAGGTGGTGAAGGGGCTCTCGTTCTTGGGTACTACCAAGAGAAGTGCCCTCTGTTGGAAGAAATC
GTGCGGCATAGTGTCGAGCGTGCAGTGTATAGAGAGCCTCGGATGGCAGCATCTCTGCTACGTGTCCATTTTCACGACTGTTTCGTCATG
GTTAGAGGAACATCTCTCTCTCAATCTCTT
GCGCGCCCTCTCTTGGGTGACACTGTAAATGATTTACAATATCCTATTGATTTGTGAAGTTGCAGTACTTGAATGTACACAGCAACTAGAAAATGTCTCATAAATTGACATTAGAGATTT
CCATCAGTTCATCTGCCTAAATAAACCAGAACATGAGACGGTCCCTTTTAACTTTTCGTGGGAAAAGTAATTAGTATTTTCATTTTCCAGCCGCATCTTCTCTATGGGCTAACATCTTGT
GTCATTCTTTTGAGGATTAGGGTTGCGATGCATCAGTTCTTCTAGACAGCTTTGATGGCATGGTGAGCGAGAAGCAGGCAGTGCCTAACCTTAACTCCTTGCGTGGGTTCGAGGTGATTG
ACGAGATAAAGTATAATCTGGAAGAGGCGTGTCCATACACAGTCTCCTGTGCTGATATTTTGGCCATTGTTGCTCGAGATGCAGTCGAGCTG
GTAAGTAACTCAGGAAGCCATTTCTGAT
TGGAAAAATTTTAGTAGCCAGATACATTGTATGTTCACGTCATGAGTCGGTCAATCAAGATTTCTATTTCTGATGGACTCGTTCTTACTCTAAACCTAACCTTTCTCTAGTACGTCCACA
CTTAGCATCATATACACTGAGAAATTTCTTATCTCTGTAAAAAAGAGAGGAGGGCCCAGGTGGGAAGTGTGGCTAGGCAGGAGAGACTCACTCAAGGCAAGCTTTGATGGAGCCAACAAA
TTCATACCTGCTCCAAATTCCTCCCTTGAAGCCCTAATTGCTAATTTCGGGCAACAGGGCCTGGACGAAAGAGACTTGGTTGCCTTATCAG
GTGAAGTGTTTAGATTTAATTGAGTTCAA
AAGTGAAATTTCTCGCATTACAAAAAAATGGGTAATCCTTTGTTTGTAACTATTCTTGCTAAATCAATAGATTCATATCAGTTACTCATATAAAGAAGTTGGCTATGTCATCACATAAAA
TGTCTCAAAAGTTAAAAATAGCTCGAAACGAATTGCTAATGGTTTCAAGAGTTTAAAATAGTTCTCCTAATTCTTATCCTGAGTACAATTTTTTGATGCCGTGATCTTTTGTACATTTGG
CATTTCCTCTATATATTTATTGCTTTTACCAAAAAAAAAAAAGTTCTCCTAATGTGTTTCAGTACGATGACTTTCACTTAAGCATACCATCAGTTTCTTCTTCCTCCTTCCATTTGTTCT
CAGTTAACACCGTTTTGTACGTCGAAAACTACGGAAGCAGGTAGTCACACGATGGGAAAAGCACGATGCCTGAGCTTCAGGCAAGGAATTTACGAGGAAAGCACTGAACGACAGTACGAT
CCCTTCCAGAGATACACCACCTTCTACGATACCCTACAGTCCATATGCCCCGAGACCGGAAGTGATAATAGATTAGCATCGCTTGATCACGTGACGCCTTTCGAGTTCGACAACCACTAC
TTCCTTAACCTCCTCCAAGGCACGGGTCTCCTACCATCTGATAATGCCCTCATCAATGAAGACCATGAAGGTGTTATTTCGAGGCTTGTCTGGACTTATGCCTCGGATACAGAGGCTTTC
TTCCGCGACTTTGCGAACTCGGTTGTGAAGATGGGGAACATCAACGTGCTCACCGAAAGTGGAGGAGAGATCAGGAGAACATGTCGATTCATCAACACTTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGGGTATTATTGAGTGTGTTGCTACTTTTGAGTTTGTACGGAGTGGGCACTTCAGGTGGTGAAGGGGCTCTCGTTCTTGGGTACTACCAAGAGAAGTGCCCTCTGTTGGAAGAAATC
GTGCGGCATAGTGTCGAGCGTGCAGTGTATAGAGAGCCTCGGATGGCAGCATCTCTGCTACGTGTCCATTTTCACGACTGTTTCGTCATG
GGTTGCGATGCATCAGTTCTTCTAGACAGC
TTTGATGGCATGGTGAGCGAGAAGCAGGCAGTGCCTAACCTTAACTCCTTGCGTGGGTTCGAGGTGATTGACGAGATAAAGTATAATCTGGAAGAGGCGTGTCCATACACAGTCTCCTGT
GCTGATATTTTGGCCATTGTTGCTCGAGATGCAGTCGAGCTG
AGAGGAGGGCCCAGGTGGGAAGTGTGGCTAGGCAGGAGAGACTCACTCAAGGCAAGCTTTGATGGAGCCAACAAATTC
ATACCTGCTCCAAATTCCTCCCTTGAAGCCCTAATTGCTAATTTCGGGCAACAGGGCCTGGACGAAAGAGACTTGGTTGCCTTATCAG
GTAGTCACACGATGGGAAAAGCACGATGCCTG
AGCTTCAGGCAAGGAATTTACGAGGAAAGCACTGAACGACAGTACGATCCCTTCCAGAGATACACCACCTTCTACGATACCCTACAGTCCATATGCCCCGAGACCGGAAGTGATAATAGA
TTAGCATCGCTTGATCACGTGACGCCTTTCGAGTTCGACAACCACTACTTCCTTAACCTCCTCCAAGGCACGGGTCTCCTACCATCTGATAATGCCCTCATCAATGAAGACCATGAAGGT
GTTATTTCGAGGCTTGTCTGGACTTATGCCTCGGATACAGAGGCTTTCTTCCGCGACTTTGCGAACTCGGTTGTGAAGATGGGGAACATCAACGTGCTCACCGAAAGTGGAGGAGAGATC
AGGAGAACATGTCGATTCATCAACACTTAA

Retrieve as FASTA