Entry information : EgrPrx69 (Eucgr.C02744 / Egrandis_v1_0.017743m)
Entry ID 8083
Creation 2011-02-04 (Christophe Dunand)
Last sequence changes 2011-02-04 (Christophe Dunand)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2013-10-30 (Qiang Li)
Peroxidase information: EgrPrx69 (Eucgr.C02744 / Egrandis_v1_0.017743m)
Name (synonym) EgrPrx69 (Eucgr.C02744 / Egrandis_v1_0.017743m)
Class Class III peroxidase    [Orthogroup: Prx005]
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus grandis    [TaxId: 71139 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EgrPrx69
start..stop
S start..stop
EcamPrx69 689 0 1..351 1..354
EguPrx69 679 0 1..351 1..351
EglPrx69 671 0 25..351 1..327
EgrPrx83 591 0 25..351 1..327
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 52525492..52525788 297 N° 2 52526169..52526354 186 N° 3 52526600..52526765 166 N° 4 52527214..52527620 407
join(52525492..52525788,52526169..52526354,52526600..52526765,52527214..52527620 )


exon

Literature and cross-references EgrPrx69 (Eucgr.C02744 / Egrandis_v1_0.017743m)
DNA ref. Phytozome 12:   scaffold_3 (52525492..52527620)
Protein sequence: EgrPrx69 (Eucgr.C02744 / Egrandis_v1_0.017743m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   352
PWM (Da):   %s   38212.68  
PI (pH):   %s   8.61
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSVERLQPITKIKRQQSRSSWHKAMACPKLILSCLLLQLMFSFLVLKVAHGQGLEVGFYQKACPNAEAIVKEVIGQVMSVAPSLSGPLLRLHFHDCFVRGCEGSVLLNSPTNQSEKDAPQNHNLRGFQTIDRVKTALEKACPGIVSCADILALVARDVVVATGGLFYDVETGRRDGCVSILGEASNDLIPSTANITTLKADFAKRGLSVKDLVVLSGGHTIGTSHCTAFSNRLYNFTGKGDTDPTLDSNYVARLKLSCKPNDQTTLVEMDPGSVRTFDIKYFDLIAKRRGLFTSDAALLDDSQTKAYLDFQIKTGGSTFFKDFGESMVKMGRIGVLTETSGEVRKVCSKVN*

Retrieve as FASTA  
Remarks Complete sequence from genomic. Correct prediction from phytozome.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCCGTGGAACGTCTACAGCCAATCACTAAGATTAAGAGACAGCAATCACGTTCTTCTTGGCACAAAGCAATGGCTTGTCCGAAGCTCATCTTGTCTTGCTTGTTGCTTCAGTTGATG
TTCTCGTTTCTTGTTCTTAAGGTCGCTCACGGTCAAGGTCTCGAAGTAGGGTTTTACCAGAAGGCATGCCCAAATGCAGAGGCAATCGTGAAGGAAGTCATCGGCCAAGTCATGTCCGTC
GCTCCGAGTCTCTCTGGCCCTCTCTTGAGGCTGCATTTTCATGATTGTTTCGTTAGG
GTAAGTAAGAGAGCAAGCTCACATGCTTCTCTTCCTACTATGCATCCGAAGTTTACCATTTTC
GAATTACATGATAATTTGCATGTAACTAATGTTCGGATTCTAAGATGAGTAGTAATTGGCAAAAAAAGAGGGTGAGAAGTTAGATCTTGGGCTTTCATCTGAAGGGTAAATGCATGGTAG
GGATGCATAGAGATTCACAAAATTGAATTGCCGGACAACAATTTGATAAAATGAAAAATGTGTATTCGATCTAGTAATATCCTAATAAATGTTATTTGGCTCTCATCATCCTTCTCTTGA
TTCGTCTTTGGTTACGAACTATTGTCTTCATGGACTCGTGGTTGAATAAAATGCTTTGTTTCTGGGCTTTTCCACAGGGTTGTGAAGGTTCGGTACTATTGAACTCTCCGACCAATCAAT
CCGAGAAGGATGCCCCTCAGAATCACAACCTTCGAGGTTTCCAAACGATAGATAGAGTCAAAACGGCATTGGAGAAGGCATGCCCCGGCATCGTTTCGTGTGCTGACATCTTGGCCCTTG
TCGCTAGAGACGTTGTCGTCGCG
GTGCGTGCATATTCATACATCACATCCTCTGTATTTTATTCTCAAATTTGAATCTTTGTTACATAAGTACGACGTTAGTAGAATTCTCAATTTTTGC
AAACAATCTGTGTTATCTCCTTGGAAAAACAAATATTAGCCACACGTATAATAGAGAATAAGCACCGACAATTTTTGTTAATGAGAAATGCATTTTTATATAGAATTTGGGTTTTTTTTT
TTTTTTGTTGTTGTTGTTGTCACTTTAGACTGGAGGACTTTTCTATGACGTGGAAACCGGACGAAGAGATGGGTGTGTTTCTATTTTGGGGGAGGCATCTAACGATTTAATACCGTCTAC
AGCCAACATTACTACTCTGAAAGCAGATTTTGCAAAGAGAGGCCTCAGCGTGAAGGACCTTGTTGTCTTATCAG
GTAACGCCTAATCTCCAATTACTGCTTCACATGCTTTGTAAAATAT
TTTGGGGAAATTTTCGAAAAGATGTGCCAATGTCCGTACTTAGCTTAGGCAACACAGGTCAAGCTTAGCCATCTTCCCTTTCATTCTTCAGGTGGTCTGTAATTTTCCATGCACTCAGGC
AAAATGAAACGAAGTTACTTATGCAATTTTTTTTTTCTTTTTTGATAACCTCAAACCAATTTGGGCTAGGCCGTAGCGATCTCTAAACCCACGAATGAAAGCTCAAGAGGTGGAAGGTAT
TCCTTTGATCGGGGTACAATCTCTAAAAAGAGATAAGACATAAATTAATCGGGAAAAAAAACTGTAATTTGAGCACGAGATACATAAACACAGTCACCAATACAGGGAGAAAACGTAATT
TGTAACGGTGGATCATGCTAATTCTGATTTGCTATTGAGTAGGTGGGCACACCATTGGAACATCACACTGCACTGCCTTCTCCAACCGCCTCTACAACTTCACCGGAAAGGGCGACACTG
ACCCCACGCTCGACTCCAACTACGTAGCAAGATTGAAGCTCAGTTGCAAGCCGAATGACCAAACCACTCTCGTCGAGATGGACCCAGGAAGCGTGAGGACGTTCGACATCAAGTACTTCG
ATCTCATCGCAAAGAGAAGAGGCCTCTTTACTTCGGACGCCGCACTTCTTGACGACAGCCAAACCAAGGCATACCTTGACTTTCAAATCAAGACCGGTGGATCCACTTTCTTCAAGGACT
TTGGAGAGTCAATGGTGAAAATGGGTCGGATTGGCGTGCTCACCGAAACGTCTGGTGAAGTCAGGAAAGTGTGTTCAAAGGTTAATTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCCGTGGAACGTCTACAGCCAATCACTAAGATTAAGAGACAGCAATCACGTTCTTCTTGGCACAAAGCAATGGCTTGTCCGAAGCTCATCTTGTCTTGCTTGTTGCTTCAGTTGATG
TTCTCGTTTCTTGTTCTTAAGGTCGCTCACGGTCAAGGTCTCGAAGTAGGGTTTTACCAGAAGGCATGCCCAAATGCAGAGGCAATCGTGAAGGAAGTCATCGGCCAAGTCATGTCCGTC
GCTCCGAGTCTCTCTGGCCCTCTCTTGAGGCTGCATTTTCATGATTGTTTCGTTAGG
GGTTGTGAAGGTTCGGTACTATTGAACTCTCCGACCAATCAATCCGAGAAGGATGCCCCTCAG
AATCACAACCTTCGAGGTTTCCAAACGATAGATAGAGTCAAAACGGCATTGGAGAAGGCATGCCCCGGCATCGTTTCGTGTGCTGACATCTTGGCCCTTGTCGCTAGAGACGTTGTCGTC
GCG
ACTGGAGGACTTTTCTATGACGTGGAAACCGGACGAAGAGATGGGTGTGTTTCTATTTTGGGGGAGGCATCTAACGATTTAATACCGTCTACAGCCAACATTACTACTCTGAAAGCA
GATTTTGCAAAGAGAGGCCTCAGCGTGAAGGACCTTGTTGTCTTATCAG
GTGGGCACACCATTGGAACATCACACTGCACTGCCTTCTCCAACCGCCTCTACAACTTCACCGGAAAGGGC
GACACTGACCCCACGCTCGACTCCAACTACGTAGCAAGATTGAAGCTCAGTTGCAAGCCGAATGACCAAACCACTCTCGTCGAGATGGACCCAGGAAGCGTGAGGACGTTCGACATCAAG
TACTTCGATCTCATCGCAAAGAGAAGAGGCCTCTTTACTTCGGACGCCGCACTTCTTGACGACAGCCAAACCAAGGCATACCTTGACTTTCAAATCAAGACCGGTGGATCCACTTTCTTC
AAGGACTTTGGAGAGTCAATGGTGAAAATGGGTCGGATTGGCGTGCTCACCGAAACGTCTGGTGAAGTCAGGAAAGTGTGTTCAAAGGTTAATTAA

Retrieve as FASTA