Entry information : EgrPrx146 (Eucgr.J00503 / Egrandis_v1_0.045364m)
Entry ID 8115
Creation 2011-02-04 (Christophe Dunand)
Last sequence changes 2011-02-07 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2013-10-30 (Qiang Li)
Peroxidase information: EgrPrx146 (Eucgr.J00503 / Egrandis_v1_0.045364m)
Name (synonym) EgrPrx146 (Eucgr.J00503 / Egrandis_v1_0.045364m)
Class Class III peroxidase    [Orthogroup: Prx032]
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus grandis    [TaxId: 71139 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EgrPrx146
start..stop
S start..stop
EcamPrx146 645 0 1..323 1..323
EguPrx146 614 0 1..323 1..323
EglPrx146 595 0 1..323 1..319
EguPrx62 452 6e-161 1..320 4..325
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 5368615..5368833 219 N° 2 5368952..5369131 180 N° 3 5369245..5369404 160 N° 4 5369495..5369907 413
join(5368615..5368833,5368952..5369131,5369245..5369404,5369495..5369907)


exon

Literature and cross-references EgrPrx146 (Eucgr.J00503 / Egrandis_v1_0.045364m)
DNA ref. Phytozome 12:   scaffold_10 (5368615..5369907)
Protein sequence: EgrPrx146 (Eucgr.J00503 / Egrandis_v1_0.045364m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   324 (299)
PWM (Da):   %s   34051.86 (31640.6) Transmb domain:   %s   i7-29o
PI (pH):   %s   9.54 (9.33) Peptide Signal:   %s   cut: 25 range:25-323
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSTGSRLALALALVLSTIAPPCSAALRAGFYKGKCGLVDVESVVATIVASRFSKDPSIVAALLRLQFHDCFVNGCDASILLDGSSSEKTAGPNLSVRGYDLIDAAKAAVEAICPRVVSCADIIVMATRDAVALAKGGRYSVQTGRLDGKISLAQNVNLPGPSMTVSQAASAFARKGFTISDMVILLGGHTVGITHCSLFQDRLYNFNGLGKPDPTMDPKLVAALRPRCPQTATIDNTVNLDQNSSSALVVDNSFYKQIVARRGILQIDQELALDRLSKSLVATLANATNFSARFGLAMVKLGALQSRLPGEIRSSCRAINKRS*

Retrieve as FASTA  
Remarks Complete sequence from genomic. Correct prediction from phytozome.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCGACGGGAAGTAGATTGGCGTTGGCCCTCGCTCTCGTCCTCTCGACCATCGCGCCCCCATGCTCCGCCGCTCTCCGGGCAGGGTTCTACAAAGGCAAGTGTGGCCTTGTGGATGTC
GAGTCCGTGGTCGCGACCATCGTGGCCTCCCGGTTCTCCAAGGACCCGTCCATTGTGGCCGCGCTGCTCCGCTTGCAGTTCCACGATTGCTTCGTCAAT
GTATGTAAATCTTTGCATAAT
TCGATCCTCAACTTCCAGAGCACGTACTTCCGATGTACTCTAAAGCCGTCGTGATGACCGATCGATGCTAATGTTGCGTCCTTTTTTCCCCTTGAAGGGCTGTGACGCGTCGATCCTGCT
AGACGGGAGCTCGAGCGAGAAAACGGCGGGGCCGAATTTGAGCGTGAGGGGCTACGATCTTATCGACGCAGCCAAGGCTGCGGTCGAGGCCATCTGCCCCAGAGTCGTTTCTTGCGCTGA
CATCATCGTCATGGCAACTCGGGACGCTGTCGCTTTG
GTAATGGAAAGAAAAATTACTTCAAACCCCATCGTACCCGATTCGAATTCGGTCGTGTCATGTTCGGATTAGCCCTAATGCTA
TCTCGAAAACTCATTTTCGTTCAATTTCAGGCCAAAGGAGGAAGGTACAGTGTGCAAACGGGGAGGCTGGATGGCAAGATATCGCTGGCCCAAAATGTGAATCTCCCAGGTCCTTCCATG
ACAGTTTCTCAGGCTGCTTCGGCCTTTGCTCGAAAGGGATTCACCATCTCCGACATGGTCATTCTTCTAG
GTACCGACGGTGTATGCTATAATTATACTAATCGCTTTTGGTAGACGGCT
TCGGACTTAACTTATATACGCATCATTCGGACTTCGTCAGGTGGCCACACTGTCGGGATTACGCACTGCTCCCTCTTCCAAGACCGGCTCTACAACTTCAACGGATTGGGGAAGCCCGAC
CCGACCATGGATCCTAAGCTCGTGGCTGCCCTCCGGCCAAGGTGCCCGCAGACCGCGACCATCGATAACACCGTGAACCTGGACCAGAATTCTTCGAGCGCGCTCGTCGTCGACAATTCC
TTCTACAAGCAAATAGTTGCCCGGAGAGGGATTCTGCAGATCGACCAAGAGCTAGCGCTCGATAGGCTGAGCAAGTCCCTGGTGGCAACACTGGCCAATGCCACCAACTTCTCCGCTCGG
TTCGGCCTCGCCATGGTCAAGCTGGGTGCTCTCCAGAGCCGCTTGCCCGGCGAAATTAGGAGTTCTTGCCGAGCCATAAACAAAAGGAGTTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCGACGGGAAGTAGATTGGCGTTGGCCCTCGCTCTCGTCCTCTCGACCATCGCGCCCCCATGCTCCGCCGCTCTCCGGGCAGGGTTCTACAAAGGCAAGTGTGGCCTTGTGGATGTC
GAGTCCGTGGTCGCGACCATCGTGGCCTCCCGGTTCTCCAAGGACCCGTCCATTGTGGCCGCGCTGCTCCGCTTGCAGTTCCACGATTGCTTCGTCAAT
GGCTGTGACGCGTCGATCCTG
CTAGACGGGAGCTCGAGCGAGAAAACGGCGGGGCCGAATTTGAGCGTGAGGGGCTACGATCTTATCGACGCAGCCAAGGCTGCGGTCGAGGCCATCTGCCCCAGAGTCGTTTCTTGCGCT
GACATCATCGTCATGGCAACTCGGGACGCTGTCGCTTTG
GCCAAAGGAGGAAGGTACAGTGTGCAAACGGGGAGGCTGGATGGCAAGATATCGCTGGCCCAAAATGTGAATCTCCCAGGT
CCTTCCATGACAGTTTCTCAGGCTGCTTCGGCCTTTGCTCGAAAGGGATTCACCATCTCCGACATGGTCATTCTTCTAG
GTGGCCACACTGTCGGGATTACGCACTGCTCCCTCTTCCAA
GACCGGCTCTACAACTTCAACGGATTGGGGAAGCCCGACCCGACCATGGATCCTAAGCTCGTGGCTGCCCTCCGGCCAAGGTGCCCGCAGACCGCGACCATCGATAACACCGTGAACCTG
GACCAGAATTCTTCGAGCGCGCTCGTCGTCGACAATTCCTTCTACAAGCAAATAGTTGCCCGGAGAGGGATTCTGCAGATCGACCAAGAGCTAGCGCTCGATAGGCTGAGCAAGTCCCTG
GTGGCAACACTGGCCAATGCCACCAACTTCTCCGCTCGGTTCGGCCTCGCCATGGTCAAGCTGGGTGCTCTCCAGAGCCGCTTGCCCGGCGAAATTAGGAGTTCTTGCCGAGCCATAAAC
AAAAGGAGTTGA

Retrieve as FASTA