Entry information : EgrPrx149 (Eucgr.J01614 / Egrandis_v1_0.043998m)
Entry ID 8121
Creation 2011-02-04 (Christophe Dunand)
Last sequence changes 2011-02-07 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2013-10-30 (Qiang Li)
Peroxidase information: EgrPrx149 (Eucgr.J01614 / Egrandis_v1_0.043998m)
Name (synonym) EgrPrx149 (Eucgr.J01614 / Egrandis_v1_0.043998m)
Class Class III peroxidase    [Orthogroup: Prx018]
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus grandis    [TaxId: 71139 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EgrPrx149
start..stop
S start..stop
EguPrx149 624 0 1..309 1..309
EglPrx149 618 0 1..309 1..309
EguPrx150 601 0 1..309 1..309
EgrPrx150 595 0 1..309 1..309
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 21072668..21072829 162 N° 2 21073057..21073824 768  
join(21072668..21072829,21073057..21073824)


exon

Literature and cross-references EgrPrx149 (Eucgr.J01614 / Egrandis_v1_0.043998m)
DNA ref. Phytozome 12:   scaffold_10 (21072668..21073824)
Protein sequence: EgrPrx149 (Eucgr.J01614 / Egrandis_v1_0.043998m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   310
PWM (Da):   %s   33314.51  
PI (pH):   %s   7.79
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MLNSGSATLQVGFYHSTCPSVESVVRKAVNKAVARNPGIGAGLIRMHFHDCFVRGCDASILLDSTPGNPAEKEHPANNPSLRGYEVIDEAKAELEYLCPQTVSCADILAFAARDSTYKLGSINYAVPAGRRDGLVSLRDEPSQNLPPPSLDAQQLEANFARKGLSLDEMVTLSGAHSVGVSHCSSFSTRLSSFNATHKQDPSMEPRMASELKAKCLNNGGASDPTVPLDFATPNRLDNKYYTNLKDHRGVLTSDQTLFDSPSTAYIVRKHANHGGAWANKFAAAMVKMGSIDILTGNQGEIRRNCRVVN*

Retrieve as FASTA  
Remarks Complete sequence from genomic. Correct prediction from phytozome.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCTGAACTCAGGTTCGGCGACTCTCCAAGTGGGATTCTACCACTCCACCTGCCCGTCCGTGGAGTCCGTCGTTCGAAAAGCCGTGAACAAGGCGGTGGCCAGAAATCCTGGCATTGGT
GCTGGGCTTATTAGAATGCACTTCCATGATTGCTTTGTTCGG
GTATGCAAACACTTCTTGCCACATTTCTGAAGTAGCAGTGACAATCTCAATTTCGATAAGTAGCAGCGGCTATAAACT
TTTCCTAGTGAAAAGCATTCTTGTGATATTTTTTTTATAACAAAGGATGTTAACTAGATGTGAGTATAGAGTACAATAGTAACGTAATTCCTTATGCAGATGCATTTCAGCAATCCTGAT
AATGTTCCTGTTTTCTGATACAATAATAGGGTTGCGATGCATCAATTTTGCTCGATTCAACACCGGGCAACCCAGCAGAGAAGGAACATCCCGCGAACAACCCAAGCTTACGAGGCTACG
AAGTCATTGACGAGGCAAAGGCCGAGCTAGAGTATCTATGCCCCCAGACGGTCTCTTGCGCCGACATTCTCGCGTTCGCGGCCCGCGACAGCACCTACAAGCTCGGCAGCATTAACTATG
CAGTCCCGGCCGGTCGCCGTGATGGGCTAGTCTCCCTCAGAGACGAGCCGTCCCAGAATCTTCCCCCTCCTTCCTTAGATGCTCAACAGTTGGAAGCTAATTTCGCAAGAAAAGGTCTCT
CTCTAGACGAAATGGTGACACTATCCGGTGCGCATTCGGTTGGAGTCTCGCACTGTTCCTCCTTCTCGACCCGCTTGTCCTCCTTCAACGCCACGCACAAGCAAGACCCTTCAATGGAAC
CCAGGATGGCCAGTGAACTGAAAGCGAAGTGCCTGAATAACGGAGGCGCCAGCGATCCGACGGTCCCACTGGACTTTGCCACGCCCAACAGGCTCGACAACAAGTACTACACTAATTTGA
AGGACCACCGAGGCGTATTAACTTCCGATCAGACACTTTTTGATAGCCCTTCGACAGCATATATCGTGAGGAAGCACGCGAATCATGGTGGAGCATGGGCTAACAAGTTCGCAGCTGCTA
TGGTAAAGATGGGATCGATCGATATTCTCACCGGGAACCAGGGCGAGATTAGGAGAAATTGTAGAGTTGTGAACTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCTGAACTCAGGTTCGGCGACTCTCCAAGTGGGATTCTACCACTCCACCTGCCCGTCCGTGGAGTCCGTCGTTCGAAAAGCCGTGAACAAGGCGGTGGCCAGAAATCCTGGCATTGGT
GCTGGGCTTATTAGAATGCACTTCCATGATTGCTTTGTTCGG
GGTTGCGATGCATCAATTTTGCTCGATTCAACACCGGGCAACCCAGCAGAGAAGGAACATCCCGCGAACAACCCAAGC
TTACGAGGCTACGAAGTCATTGACGAGGCAAAGGCCGAGCTAGAGTATCTATGCCCCCAGACGGTCTCTTGCGCCGACATTCTCGCGTTCGCGGCCCGCGACAGCACCTACAAGCTCGGC
AGCATTAACTATGCAGTCCCGGCCGGTCGCCGTGATGGGCTAGTCTCCCTCAGAGACGAGCCGTCCCAGAATCTTCCCCCTCCTTCCTTAGATGCTCAACAGTTGGAAGCTAATTTCGCA
AGAAAAGGTCTCTCTCTAGACGAAATGGTGACACTATCCGGTGCGCATTCGGTTGGAGTCTCGCACTGTTCCTCCTTCTCGACCCGCTTGTCCTCCTTCAACGCCACGCACAAGCAAGAC
CCTTCAATGGAACCCAGGATGGCCAGTGAACTGAAAGCGAAGTGCCTGAATAACGGAGGCGCCAGCGATCCGACGGTCCCACTGGACTTTGCCACGCCCAACAGGCTCGACAACAAGTAC
TACACTAATTTGAAGGACCACCGAGGCGTATTAACTTCCGATCAGACACTTTTTGATAGCCCTTCGACAGCATATATCGTGAGGAAGCACGCGAATCATGGTGGAGCATGGGCTAACAAG
TTCGCAGCTGCTATGGTAAAGATGGGATCGATCGATATTCTCACCGGGAACCAGGGCGAGATTAGGAGAAATTGTAGAGTTGTGAACTAG

Retrieve as FASTA