Entry information : EgrPrx151 (Eucgr.J01616 / Egrandis_v1_0.042753m)
Entry ID 8126
Creation 2011-02-04 (Christophe Dunand)
Last sequence changes 2011-02-07 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2012-12-04 (Qiang Li)
Peroxidase information: EgrPrx151 (Eucgr.J01616 / Egrandis_v1_0.042753m)
Name (synonym) EgrPrx151 (Eucgr.J01616 / Egrandis_v1_0.042753m)
Class Class III peroxidase    [Orthogroup: Prx018]
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus grandis    [TaxId: 71139 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EgrPrx151
start..stop
S start..stop
EcamPrx151 642 0 1..315 9..323
EglPrx151 637 0 1..315 1..315
EguPrx153 635 0 1..315 1..315
EgrPrx153 634 0 1..315 1..315
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 21088383..21088562 180 N° 2 21088859..21089626 768  
join(21088383..21088562,21088859..21089626)


exon

Literature and cross-references EgrPrx151 (Eucgr.J01616 / Egrandis_v1_0.042753m)
DNA ref. Phytozome 12:   scaffold_10 (21088383..21089626)
Protein sequence: EgrPrx151 (Eucgr.J01616 / Egrandis_v1_0.042753m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   316
PWM (Da):   %s   33884.85  
PI (pH):   %s   8.39
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MFSFITFLNSGSATLQVGFYRSTCPSAESVVRKAVNKAVAKNSGIGAGLIRMHFHDCFVRGCDASILLDSTPGNPSEKEHPANNPSLRGFEVIDEAKAELESLCPQKVSCADILAFAARDSAYKLGSINYAVPAGRRDGLVSLKDEPSQDLPPFFFNAQQLEANFARKGLSLDEMVTLSGAHSIGVSHCSSFSNRLYSFNATHTQDPSMDTKLATQLKSKCPNNGGASDPTVPLDLVTPNRLDNKYYTNLKNRRGLLTSDQTLSNSPSTANIVRSNANNGGAWANKFAAAMVKMGSIDVLTGNEGEIRRKCMVVN*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 10, intron 1). Incorrect prediction from phytozome (Very short 3' end is missing). Also detected in scaffold_900 (6933..5693).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTTCTCGTTCATCACCTTTCTGAACTCGGGTTCAGCAACTCTCCAAGTGGGATTCTACCGCTCCACTTGTCCGTCTGCGGAGTCCGTCGTCCGGAAAGCAGTGAACAAAGCGGTGGCC
AAGAACTCCGGCATCGGTGCTGGGCTTATTAGAATGCACTTCCATGATTGCTTTGTTCGG
GTATGCAAGAACTTCTTTACACATTTCAGAAATAGTGGTTATAATCTCGTTTGCGGAAAA
ATAGTAATGCAAGGAAAACCTTTTTTTTTTTAAGCAAAAAGCGTATGCCTATCTTTTGTTAGTACAAAAGATATCGATGAGATGGGAGTGTGGGGAGTACATTTCACATTCTATCACTGG
TCCAGGACTTTTTAAGTTTTGTCTAACCGACCGGTCACAAAATAATCTATATTTCTTGTGCAGATGCACTTCAGCTATCCTGATAATTGCTTTGTTGTTCTTTGATCCAATAATAGGGCT
GCGACGCTTCGATCTTGCTAGATTCGACCCCAGGCAACCCATCAGAGAAGGAACATCCAGCGAACAACCCGAGCTTACGAGGTTTTGAAGTCATTGACGAGGCAAAGGCTGAGCTAGAGT
CTCTATGCCCGCAGAAGGTCTCATGCGCTGACATTCTTGCATTCGCAGCACGCGACAGTGCCTACAAACTCGGCAGCATCAACTACGCAGTCCCAGCGGGTCGCCGCGATGGGCTGGTCT
CACTCAAAGACGAGCCCTCCCAGGATCTTCCTCCTTTCTTCTTCAATGCGCAACAATTAGAAGCTAATTTTGCGAGAAAAGGCCTCTCTCTGGACGAGATGGTGACGCTATCCGGTGCAC
ATTCCATTGGAGTCTCGCATTGCTCCTCCTTCTCGAACCGCTTGTACTCCTTCAATGCCACTCACACCCAAGACCCTTCAATGGACACCAAGTTGGCTACTCAACTGAAATCTAAGTGTC
CGAACAATGGAGGCGCTAGCGATCCCACTGTGCCATTGGACTTGGTCACGCCGAACAGGCTAGACAACAAGTACTACACTAATTTGAAGAACCGCCGAGGCCTATTGACTTCTGATCAGA
CTCTTTCTAACAGCCCTTCGACGGCGAATATTGTGAGGAGCAATGCAAATAATGGCGGAGCATGGGCTAACAAGTTCGCGGCGGCAATGGTGAAGATGGGATCGATTGACGTCCTCACCG
GGAACGAGGGTGAGATTAGGAGGAAATGCATGGTGGTGAACTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTTCTCGTTCATCACCTTTCTGAACTCGGGTTCAGCAACTCTCCAAGTGGGATTCTACCGCTCCACTTGTCCGTCTGCGGAGTCCGTCGTCCGGAAAGCAGTGAACAAAGCGGTGGCC
AAGAACTCCGGCATCGGTGCTGGGCTTATTAGAATGCACTTCCATGATTGCTTTGTTCGG
GGCTGCGACGCTTCGATCTTGCTAGATTCGACCCCAGGCAACCCATCAGAGAAGGAACAT
CCAGCGAACAACCCGAGCTTACGAGGTTTTGAAGTCATTGACGAGGCAAAGGCTGAGCTAGAGTCTCTATGCCCGCAGAAGGTCTCATGCGCTGACATTCTTGCATTCGCAGCACGCGAC
AGTGCCTACAAACTCGGCAGCATCAACTACGCAGTCCCAGCGGGTCGCCGCGATGGGCTGGTCTCACTCAAAGACGAGCCCTCCCAGGATCTTCCTCCTTTCTTCTTCAATGCGCAACAA
TTAGAAGCTAATTTTGCGAGAAAAGGCCTCTCTCTGGACGAGATGGTGACGCTATCCGGTGCACATTCCATTGGAGTCTCGCATTGCTCCTCCTTCTCGAACCGCTTGTACTCCTTCAAT
GCCACTCACACCCAAGACCCTTCAATGGACACCAAGTTGGCTACTCAACTGAAATCTAAGTGTCCGAACAATGGAGGCGCTAGCGATCCCACTGTGCCATTGGACTTGGTCACGCCGAAC
AGGCTAGACAACAAGTACTACACTAATTTGAAGAACCGCCGAGGCCTATTGACTTCTGATCAGACTCTTTCTAACAGCCCTTCGACGGCGAATATTGTGAGGAGCAATGCAAATAATGGC
GGAGCATGGGCTAACAAGTTCGCGGCGGCAATGGTGAAGATGGGATCGATTGACGTCCTCACCGGGAACGAGGGTGAGATTAGGAGGAAATGCATGGTGGTGAACTAG

Retrieve as FASTA