Entry information : SmPrx[P]54a_16
Entry ID 8142
Creation 2011-02-23 (Christophe Dunand)
Last sequence changes 2011-02-23 (Christophe Dunand)
Sequence status theoretical translation / pseudogene
Reviewer Not yet reviewed
Last annotation changes 2011-02-23 (Christophe Dunand)
Peroxidase information: SmPrx[P]54a_16
Name SmPrx[P]54a_16
Class Class III peroxidase     [Orthogroup: Prx006]*
Taxonomy Eukaryota Viridiplantae Streptophyta Isoetopsida Selaginellaceae Selaginella
Organism Selaginella moellendorffii    [TaxId: 88036 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SmPrx[P]54a_16
start..stop
S start..stop
SmPrx[P]53b_1 508 0 1..251 1..251
SmPrx[P]53a_16 508 0 1..251 1..251
SmPrx52-2_1 509 0 1..251 96..346
SmPrx52-1_16 509 0 1..251 96..346
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1499907..1500261 355 N° 2 1499429..1499829 401  
complement(join(1499429..1499829,1499907..1500261))


exon

Literature and cross-references SmPrx[P]54a_16
DNA ref. Phytozome 12:   scaffold_16 (1500261..1499429)
Protein sequence: SmPrx[P]54a_16
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   251
PWM (Da):   %s   26973.86  
PI (pH):   %s   7.8
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
GCDASILLDSKGSIKSERDSDKNFGIRRLDFIDRIKSMLEAACPGVVSCADIIVLVARESIVFTGGPTIPVLTGRRDGTAASNAAADRLLPPATVSVDNFISLFASKGLSLDESVAIIGAHTIGVGHCVNIVNRLYPNQDSKIGLLFASRLRVQCPTANPRMLNNITVINNDMTNLVFDNQYFRDLMNGQGLFTIDSELALDSRTSPVVARFSTNQQLFLDTFSSAFVKLTSSNVLTGQSGQVRKYCHSVN

Retrieve as FASTA  
Remarks Pseudogene (first exon is missing)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
GGTTGCGACGCGTCCATCTTGCTCGACTCGAAAGGTTCCATCAAAAGCGAAAGAGACTCGGACAAGAACTTTGGCATCCGCCGCTTGGATTTCATCGACAGGATCAAGTCGATGCTGGAG
GCCGCCTGTCCGGGAGTCGTCTCGTGCGCGGACATCATCGTTCTGGTGGCCAGAGAATCCATCGTCTTCACCGGAGGCCCGACCATCCCCGTGCTCACAGGAAGAAGAGACGGCACAGCC
GCTTCCAACGCCGCAGCCGACAGGCTCTTGCCTCCGGCAACCGTAAGCGTCGACAACTTCATCAGCCTCTTCGCATCCAAGGGCCTCTCTCTCGACGAAAGCGTTGCAATCATCG
GTACG
TCTCAAAGGCTTTTCTTTCCAGGACACTTTCCAAGGACGATTGATCCGAACTTCTGTACTTTTGCATTCCAGGAGCTCACACAATTGGAGTCGGGCACTGCGTCAACATTGTGAATCGGC
TCTATCCAAACCAGGACAGTAAGATCGGCCTCCTGTTTGCGAGCCGGCTGAGAGTCCAGTGCCCGACGGCCAATCCCCGGATGCTCAACAACATTACAGTGATCAACAACGATATGACCA
ACCTCGTCTTTGACAACCAGTACTTCCGGGACCTTATGAACGGGCAGGGGCTCTTCACCATCGATTCGGAGCTTGCGCTGGACAGCCGCACGTCGCCCGTGGTAGCGCGCTTCTCTACGA
ACCAGCAGCTCTTCCTCGACACATTCTCTTCGGCTTTCGTCAAGCTCACGTCCAGCAATGTCTTGACAGGACAGAGTGGACAGGTTCGAAAGTACTGCCACTCAGTGAACTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
GGTTGCGACGCGTCCATCTTGCTCGACTCGAAAGGTTCCATCAAAAGCGAAAGAGACTCGGACAAGAACTTTGGCATCCGCCGCTTGGATTTCATCGACAGGATCAAGTCGATGCTGGAG
GCCGCCTGTCCGGGAGTCGTCTCGTGCGCGGACATCATCGTTCTGGTGGCCAGAGAATCCATCGTCTTCACCGGAGGCCCGACCATCCCCGTGCTCACAGGAAGAAGAGACGGCACAGCC
GCTTCCAACGCCGCAGCCGACAGGCTCTTGCCTCCGGCAACCGTAAGCGTCGACAACTTCATCAGCCTCTTCGCATCCAAGGGCCTCTCTCTCGACGAAAGCGTTGCAATCATCG
GAGCT
CACACAATTGGAGTCGGGCACTGCGTCAACATTGTGAATCGGCTCTATCCAAACCAGGACAGTAAGATCGGCCTCCTGTTTGCGAGCCGGCTGAGAGTCCAGTGCCCGACGGCCAATCCC
CGGATGCTCAACAACATTACAGTGATCAACAACGATATGACCAACCTCGTCTTTGACAACCAGTACTTCCGGGACCTTATGAACGGGCAGGGGCTCTTCACCATCGATTCGGAGCTTGCG
CTGGACAGCCGCACGTCGCCCGTGGTAGCGCGCTTCTCTACGAACCAGCAGCTCTTCCTCGACACATTCTCTTCGGCTTTCGTCAAGCTCACGTCCAGCAATGTCTTGACAGGACAGAGT
GGACAGGTTCGAAAGTACTGCCACTCAGTGAACTAG

Retrieve as FASTA