Entry information : EgrPrx20
Entry ID 8162
Creation 2011-03-01 (Christophe Dunand)
Last sequence changes 2011-03-01 (Christophe Dunand)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2013-10-30 (Qiang Li)
Peroxidase information: EgrPrx20
Name EgrPrx20
Class Class III peroxidase    [Orthogroup: Prx010]
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus grandis    [TaxId: 71139 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EgrPrx20
start..stop
S start..stop
EgrPrx18 632 0 1..319 1..319
EguPrx17 631 0 1..319 1..319
EcamPrx20 627 0 1..319 1..319
EgrPrx17 620 0 1..319 1..319
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 10873860..10874075 216 N° 2 10875193..10875384 192 N° 3 10875505..10875670 166 N° 4 10875793..10876178 386
join(10873860..10874075,10875193..10875384,10875505..10875670,10875793..10876178 )


exon

Literature and cross-references EgrPrx20
DNA ref. Phytozome 12:   scaffold_1 (10873860..10876178)
Protein sequence: EgrPrx20
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   319 (294)
PWM (Da):   %s   33891.72 (31284.5)  
PI (pH):   %s   7.92 (8.01) Peptide Signal:   %s   cut: 26 range:26-319
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MACESSSTRPAFLLLLCFLHGTASAQLSSTFYSTSCPSALSTIKSSVSSAVKNEARMGASLLRLHFHDCFVNGCDASILLDDTTNFTGEKNAGPNANSMRGFEVIDTIKSELESKCPSIVSCADILAVVARDSIVALGGPSWTVNLGRRDSTTASQSAANISIPPPTLNLSGLISTFSNKGFTAKEMVALLGSHTIGQARCLTFREHLYNENNIDATFATSLKANCPSSGGDSKLFPFDTTSPTSFDNAFFKNLQTHKVFLHSDQQLFSGGSTDVHVNAYSSNLSTFRTDFANAMVKMGNLSPLIGSSGQIRKNCRKVN

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 1, 3 introns). No prediction from Phytozome.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTGTGAGAGCTCTTCCACCAGACCAGCCTTCTTATTGTTGCTGTGTTTCCTCCATGGAACAGCCTCTGCTCAGCTGTCCAGTACTTTCTACTCCACTTCCTGTCCCAGCGCCCTC
TCCACCATTAAATCCAGCGTGAGCTCTGCGGTCAAAAACGAGGCCCGCATGGGCGCGTCCTTGCTCCGCCTTCACTTCCACGATTGCTTCGTCAAT
GCAAGTCCCTCTGCTCTGAGTCTC
TCCTCTCTTTCCGATTGATTACTACCATTGTTTCTCTCCTTCATTCAAGCTGAATGCAAGCGAGCATGCATGATGCATCTTTGTGCCTACGCATGTGAAGCGTTCCATCCAACCACATAG
TCAAAAGAATCATTAGATTCGCTTCTACGCAAGTTACTTACTCTCTTTTTCACTAACCAAACAGTAGGTAGGAGGTTGACATATTGAATTAGTTGAGATTTTTGGTGCTTTGTTGTGTCA
TGCATTTTTGTGAGTTTATTATACCAATAATCAATTCTGTTTATTAGAGCACAATAATTTTTTTGGTAATTCGAAAAAACTTCATGATTATTTTTAGCATACATTGCCGGTGTAAAAATA
TTTTTCACAAACAATCTTATCCACCCTTAATTTGGCGGTTAGTGAGAGATTTGGTAATTAGAATCCTCAAATTACGAATGGCCAAGAATGATTATGTAAAATTTTCTTTACATTGATGGT
CTATGCTCTAATTTTCACCGGAAAAAACTATGCAGGAGAGCGTACTTTACGCTAACTATGCTGTTGATCAGATAAATGGGTATATAAATAACATTGGAGCTGGCAAAAAGAGAGAGATGG
CCATTGCTTTTTATATCGGCGGTTGACTTTACTCGGTTATCACATTTGGCTAACCAATCAGTCCTTCTCAATAGATTTTGATCACATTTTGATCACCTCGCTGTGGTAGCCATACATTTC
TACATAAAAAGTGCTATGGATGGTAAAGTATCATTTTTAATGAAATTTGATAACTCAATACTATTCTAAAATCGCACTAGATCTTTGAACAAGCAAATCGTGCCTTTTGCATGGCCTCAT
TAGTTTGCTTTCACACAAATTCAAAGTGTCAATCTAAATTAACTAATCGATTTAGATTAGTATGTTCATAATGGGGGGGGGGGGGGGGGAACTATTTCAGTAAAGATTATAGCACTTAAC
TTGTTTTTTTTTTTTTTTGGGTAAGGTATAGCACTTAACTTGTTTGCAACCATTAAATCTAATTAACTCCAATCGGATCAATTTTCTATCTAGAAGGACTGATTAACAACATGTGGCAAA
AAACATGAAATAGGGATGCGACGCGTCAATCTTATTGGACGACACTACGAACTTTACCGGGGAGAAGAACGCCGGCCCGAATGCCAATTCCATGCGGGGATTTGAGGTAATTGACACAAT
CAAGTCCGAATTGGAGAGCAAGTGCCCCAGTATTGTGTCCTGCGCTGATATTTTAGCCGTCGTTGCACGAGACTCCATCGTTGCC
GTAAGTGCACATTTTCTTCTCAATTGTACTTATCA
ATTGTGATGAAAAAAATCACATGTTATGTTCCCCATGCTATATTAATACTAACACGTATCGATTTGTTATTTATTTAATTTTTAGTTAGGTGGCCCTAGTTGGACAGTCAACCTTGGAAG
AAGAGACTCAACCACTGCAAGTCAAAGTGCTGCTAATATTAGCATTCCTCCCCCAACTTTGAACCTTAGCGGCCTAATCTCTACCTTCTCTAACAAAGGCTTCACAGCTAAAGAAATGGT
GGCACTTTTAG
GTCATTGTTTCTTTCTTCTTCTTTTTTTCTTTTTTTTTTGCAATATTTAATAAAGAATAACAATAATGCTCGATCAATATACTAAAATCAATTTACAAAAATTGTTCGA
CCATTGTTAACAGGGTCGCACACTATAGGTCAAGCCCGATGCCTGACTTTCCGGGAGCATCTTTACAATGAGAACAACATCGATGCCACGTTCGCGACATCGCTGAAAGCAAATTGCCCA
AGCTCCGGAGGCGACAGCAAACTCTTTCCTTTTGACACCACAAGCCCGACGTCCTTTGACAACGCCTTCTTCAAGAACTTGCAAACCCACAAGGTTTTTCTTCATTCGGACCAGCAATTG
TTCAGTGGTGGCTCCACGGACGTTCACGTGAATGCTTATAGTAGCAATTTGTCCACTTTTAGGACAGATTTTGCTAACGCCATGGTGAAGATGGGTAACCTTAGCCCACTCATTGGCTCA
AGCGGTCAGATTAGAAAGAATTGCAGGAAAGTCAACTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTGTGAGAGCTCTTCCACCAGACCAGCCTTCTTATTGTTGCTGTGTTTCCTCCATGGAACAGCCTCTGCTCAGCTGTCCAGTACTTTCTACTCCACTTCCTGTCCCAGCGCCCTC
TCCACCATTAAATCCAGCGTGAGCTCTGCGGTCAAAAACGAGGCCCGCATGGGCGCGTCCTTGCTCCGCCTTCACTTCCACGATTGCTTCGTCAAT
GGATGCGACGCGTCAATCTTATTG
GACGACACTACGAACTTTACCGGGGAGAAGAACGCCGGCCCGAATGCCAATTCCATGCGGGGATTTGAGGTAATTGACACAATCAAGTCCGAATTGGAGAGCAAGTGCCCCAGTATTGTG
TCCTGCGCTGATATTTTAGCCGTCGTTGCACGAGACTCCATCGTTGCC
TTAGGTGGCCCTAGTTGGACAGTCAACCTTGGAAGAAGAGACTCAACCACTGCAAGTCAAAGTGCTGCTAAT
ATTAGCATTCCTCCCCCAACTTTGAACCTTAGCGGCCTAATCTCTACCTTCTCTAACAAAGGCTTCACAGCTAAAGAAATGGTGGCACTTTTAG
GGTCGCACACTATAGGTCAAGCCCGA
TGCCTGACTTTCCGGGAGCATCTTTACAATGAGAACAACATCGATGCCACGTTCGCGACATCGCTGAAAGCAAATTGCCCAAGCTCCGGAGGCGACAGCAAACTCTTTCCTTTTGACACC
ACAAGCCCGACGTCCTTTGACAACGCCTTCTTCAAGAACTTGCAAACCCACAAGGTTTTTCTTCATTCGGACCAGCAATTGTTCAGTGGTGGCTCCACGGACGTTCACGTGAATGCTTAT
AGTAGCAATTTGTCCACTTTTAGGACAGATTTTGCTAACGCCATGGTGAAGATGGGTAACCTTAGCCCACTCATTGGCTCAAGCGGTCAGATTAGAAAGAATTGCAGGAAAGTCAACTGA

Retrieve as FASTA