Entry information : EgrPrx18
Entry ID 8180
Creation 2011-03-03 (Qiang Li)
Last sequence changes 2012-02-16 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2016-03-17 (Christophe Dunand)
Peroxidase information: EgrPrx18
Name EgrPrx18
Class Class III peroxidase    [Orthogroup: Prx010]
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus grandis    [TaxId: 71139 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EgrPrx18
start..stop
S start..stop
EgrPrx20 632 0 1..319 1..319
EcamPrx20 619 0 1..319 1..319
EgrPrx17 615 0 1..319 1..319
EguPrx17 614 0 1..319 1..319
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 10616255..10616470 216 N° 2 10617560..10617751 192 N° 3 10617861..10618026 166 N° 4 10618142..10618527 386
join(10616255..10616470,10617560..10617751,10617861..10618026,10618142..10618527 )


exon

Literature and cross-references EgrPrx18
DNA ref. Phytozome 12:   scaffold_1 (10616255..10618527)
Cluster/Prediction ref. Broad:   104453422
Protein sequence: EgrPrx18
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   319 (294)
PWM (Da):   %s   33884.69 (31277.4)  
PI (pH):   %s   7.4 (7.41) Peptide Signal:   %s   cut: 26 range:26-319
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MACESSSTRPAFLLLLCFLHGTASAQLSSTFYSTSCPSALSTIKSSVSSAVKNEARMGASLLRLDFHDCFVNGCDASILLDDTTNFTGEKNAGPNANSMRGFEVIDTIKSELESKCPGIVSCADILAVVARDSIVALGGPSWTVSLGRRDSTTASQTAANISIPPPTLNLRGLISAFSNKGFTAKEMVALLGSHTIGQARCLTFREHLYNENNIDTTFATSLKANCPSSGGDSKLFPFDTTSPTSFDNAFFKNLQTHKVFLHSDQQLFSGGSTDVHVNAYSSNLSTFSTDFANAMVKMGNLSPLIGSSDQIRKNCRKVN

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns). No prediction from Phytozome
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTGTGAGAGCTCTTCCACCAGACCAGCCTTCTTATTGTTGCTGTGTTTCCTCCATGGAACAGCCTCTGCTCAGCTGTCCAGTACTTTCTACTCCACCTCCTGTCCCAGCGCCCTC
TCCACCATCAAATCCAGCGTGAGCTCTGCGGTCAAAAACGAGGCCCGCATGGGCGCGTCCTTGCTCCGCCTTGACTTCCACGATTGCTTCGTCAAT
GCAAGTCCCTCTGCTCTGAGTCTC
TCCTCTCTTTCCGATTGATTACTACCATTGTTTCTCTCCTTCATTCAAGCTGAATGCAAGGGAGCATTCATGATGCACCTTTGTGCCTACGCATGTGAAGCGTTCCATCCAACCACATAG
TCAAAAGAATCATTAGATTCGCTTCTACGCAAGTTACGTACTCTCTTTTTCACTAATTAAACAGTAGGTAGGAGGTTGACATATTGAATTACTTGAGTCTGACCCTTTTTGGTGTTTTGT
TGTGTCATGCATTTTTGTGAGTTTATTATACCAATAATCAATTCTGTTTATTAGAGCACAATGATTTTTTTGATAATTCAAAAAAACTTCATTATTATTTTTAGCATACATTGCCGGTGT
AAAAATATTTTTCACAAACAATCTTATCCACCCTTAATTCGGCGGTGTGAGAGATTTGGTAATTAGAATCCTCAAATTACGAATGGCCAGGAATGATTATGTAAAATTTTCTTTACATTG
ATGGTCTATGCTCTAATTTACACCGGCAAAAACTATGCAGGAGAGCGTACTTTACGCCAACTAAGCTGTTGATACGATGAATGGGTATATAAATAACACTGGAGCTGGCAAAAAGAGAGA
GATGGCCATTGCTTTTTATATCGGCGGTTGACTTTACTCGGTTATCATATTTGGCTAACCAATCAGTCCTTTTCAATAGATTTTGATCACCTCGCTGTGGTAGCCATATATTTCTACATA
AAAAGTGATATGGATGGTAAAGTATGATTTTTAATGAAATTTGATAACTCAATACTATTCTAAAATCGCACTAGATATTTGAACAAGCAAATCTTGCCTTTTGCATGGCCTCATTAGTTT
GCCTTTTGCATGGCCTCATTAGTTTGCTTTCACACAAATTCAAAGTGTCAATCTAAATTAACTAATCGATTTAGATTAGTATGTTCATAATGGGGGGGCAAACTATTTCAGTAAAGATTA
TAGCATTTAACTTGTTTGCAACCATTAAATCTAATTAATTCCAATCGGATCAATTTTCTATCTAGAAGGGCTGATTAACAACATGTGGCAAAAAACATGAAATAGGGATGCGATGCGTCA
ATCTTATTGGACGACACTACGAACTTTACCGGGGAGAAGAATGCCGGCCCGAATGCCAATTCCATGCGGGGATTTGAGGTAATCGACACAATCAAGTCCGAATTGGAGAGCAAGTGCCCC
GGTATCGTGTCCTGCGCTGATATTTTAGCCGTTGTTGCACGAGACTCCATCGTTGCC
GTAAGTGCTCATTTTCTTCTCAATTCTACTTATCAATTGTGACGAAAAAAATCACATGCTATG
TTCCCCATGCTATATTAATACTAACACGTATGGATTTGTTATTTATTTAGGTGGCCCTAGTTGGACAGTCTCCCTTGGAAGAAGAGACTCAACCACTGCAAGTCAAACTGCTGCTAATAT
TAGCATTCCTCCCCCAACTTTGAACCTTAGAGGCCTAATCTCTGCCTTCTCTAACAAAGGCTTCACAGCTAAAGAAATGGTGGCACTTTTAG
GTCATTGTTTCTATTTTATTTTATTTTT
GGTTGTAATTTTTAATAAAGAATAACAATAATGCTCGATTCATATACTAAAATCAATTTACAAAAATTGTTCGACCATTGTTAACAGGGTCGCACACAATAGGTCAAGCCCGATGCCTAA
CTTTCCGGGAGCATCTTTACAACGAGAACAACATCGACACCACGTTTGCGACATCGCTGAAAGCAAATTGCCCGAGCTCCGGAGGCGACAGCAAACTCTTTCCTTTTGACACCACAAGCC
CGACGTCCTTTGACAACGCCTTCTTCAAGAACTTGCAAACCCACAAGGTTTTTCTTCATTCGGACCAGCAATTGTTCAGTGGTGGTTCCACAGACGTTCACGTGAATGCTTATAGTAGCA
ATTTGTCCACTTTTAGCACAGATTTTGCTAACGCCATGGTGAAGATGGGTAACCTTAGCCCACTCATTGGCTCAAGCGATCAGATTAGAAAGAATTGCAGGAAAGTCAACTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTGTGAGAGCTCTTCCACCAGACCAGCCTTCTTATTGTTGCTGTGTTTCCTCCATGGAACAGCCTCTGCTCAGCTGTCCAGTACTTTCTACTCCACCTCCTGTCCCAGCGCCCTC
TCCACCATCAAATCCAGCGTGAGCTCTGCGGTCAAAAACGAGGCCCGCATGGGCGCGTCCTTGCTCCGCCTTGACTTCCACGATTGCTTCGTCAAT
GGATGCGATGCGTCAATCTTATTG
GACGACACTACGAACTTTACCGGGGAGAAGAATGCCGGCCCGAATGCCAATTCCATGCGGGGATTTGAGGTAATCGACACAATCAAGTCCGAATTGGAGAGCAAGTGCCCCGGTATCGTG
TCCTGCGCTGATATTTTAGCCGTTGTTGCACGAGACTCCATCGTTGCC
TTAGGTGGCCCTAGTTGGACAGTCTCCCTTGGAAGAAGAGACTCAACCACTGCAAGTCAAACTGCTGCTAAT
ATTAGCATTCCTCCCCCAACTTTGAACCTTAGAGGCCTAATCTCTGCCTTCTCTAACAAAGGCTTCACAGCTAAAGAAATGGTGGCACTTTTAG
GGTCGCACACAATAGGTCAAGCCCGA
TGCCTAACTTTCCGGGAGCATCTTTACAACGAGAACAACATCGACACCACGTTTGCGACATCGCTGAAAGCAAATTGCCCGAGCTCCGGAGGCGACAGCAAACTCTTTCCTTTTGACACC
ACAAGCCCGACGTCCTTTGACAACGCCTTCTTCAAGAACTTGCAAACCCACAAGGTTTTTCTTCATTCGGACCAGCAATTGTTCAGTGGTGGTTCCACAGACGTTCACGTGAATGCTTAT
AGTAGCAATTTGTCCACTTTTAGCACAGATTTTGCTAACGCCATGGTGAAGATGGGTAACCTTAGCCCACTCATTGGCTCAAGCGATCAGATTAGAAAGAATTGCAGGAAAGTCAACTGA

Retrieve as FASTA