Entry information : EgrPrx23
Entry ID 8182
Creation 2011-03-04 (Qiang Li)
Last sequence changes 2011-03-04 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2012-02-15 (Qiang Li)
Peroxidase information: EgrPrx23
Name EgrPrx23
Class Class III peroxidase    [Orthogroup: Prx014]
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus grandis    [TaxId: 71139 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EgrPrx23
start..stop
S start..stop
EcamPrx23 640 0 1..319 1..319
EguPrx23 611 0 1..319 1..319
EcamPrx21 593 0 1..319 1..319
EcamPrx22 591 0 1..319 1..319
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 10988304..10988519 216 N° 2 10990234..10990425 192 N° 3 10990548..10990713 166 N° 4 10990821..10991206 386
join(10988304..10988519,10990234..10990425,10990548..10990713,10990821..10991206 )


exon

Literature and cross-references EgrPrx23
DNA ref. Phytozome 12:   scaffold_1 (10988304..10991206)
Protein sequence: EgrPrx23
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   320 (294)
PWM (Da):   %s   33504.4 (30738.0) Transmb domain:   %s   i12-34o
PI (pH):   %s   7.31 (7.31) Peptide Signal:   %s   cut: 26 range:26-319
Sequence 361
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAWESSSVRTAFLLLLSFLLGTASAQLSSTFYSTSCPSALSTIKSAVSSAVKSEARMGASLLRLHFHDCFVNGCDASVLLDDTANFTGEKNATPNANSLRGFDVIDTIKSQLESACPGVVSCADLLTVAARDSVVALGGPSWTVPLGRRDSTTASQSAANSNIPAPTLNLSGLITAFSNKGFTTKEMVALSGSHTIGQARCTSFRARLYNENNINTTFATSLKANCPSSGGDNNLSPLDTTSPTSFDNAYFKNLQIQEGLLHSDQQLFSGGSTDAQVNAYSSNSATFMTDFANAMVKMGNLSPLTGSSGQIRKNCRNVN*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 1, 3 introns). No prediction from phytozome.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGGCTTGGGAGAGCTCTTCGGTCAGAACCGCCTTTTTATTGTTGCTGTCTTTCCTACTGGGAACAGCCTCAGCTCAGCTGTCCAGTACTTTCTACTCCACCTCCTGTCCCAGCGCCCTCT
CCACCATTAAATCCGCCGTGAGCTCTGCGGTCAAAAGTGAGGCCCGCATGGGCGCATCGCTGCTCCGCCTTCATTTCCACGATTGCTTCGTTAAT
GCAAGTCCCTCTGCCCGGAGTCTCT
CCTCTCTTTCCGATTGATTGCTACCTTTGTTTCTCTTCTGTCATTCAAGCTGCATGCAAGCGTACATGCATGATGCATCTTTGTGCTTTTGTGCATGTGAAACGTTCCAACCGACCTCAT
AATCAAAAAGAATGATTAGATTTCGCTTCTACGCAAGTTACTTACTCTCTTTTTCACTAACCAAACAATAGGTAGGAAGTACACAAATTGCATTAGTCGAGTCTGACCGACCCTTTTTGT
GCCATGCATTTTTGTGAGTTTATTATTATTATAATAATAGGCTGTGTTTATTGAAGTCGTTTAAAATTAGAGCTATGTTTTCATTCAAACAGCAATAAAAAGCATGGCCCTTAGAATAAA
AGCATTTCTTTTTGGTGATTCAAAGAAAAAAATTTCATGAGTAATTCTAGTATACACCGCTAGTGTAAAAATCTCATTCCATAAGTGGTCTTATCCACTAAATATTTTGGTGGCCGGGGA
GAGATTTGGTAATTAGAATCCTCAAATCAAGATGGACAAGACTGTTGTTGTGCGTGCTCTAATTTTTTTTTTTCATTTATTAAATTGATAATGTATTCTATAACTTCATTACAAAAGCCA
TGCAGGCGAGCGTATTTTATGGCGAGTATGTTGTGGTTGTGGATAAGACGTGTGTATGTATCATTAGCTCCATGATTTTAATTCGATGAATTAGATCACGCAAAAGTCCCAAACGTTGGA
GATGGCCAAAAGAGAGAGCGACAGCCTTGCTTTTATGACGGTGGTTGACTTTACGCGTTTATCATGTTTGGCAAATCAATCTGTTGTTTTCAATAGGTTTTGGTAATATTTTGATCACCG
TCACTTTGGTTGCCATACTTTTCTACATTAAAAATGATATTTTGCCATAAAATATATTTTTTTAATGAAATTTGTTAGTCCAATGGTGTTCTAAAAATTGTATTAGATCTTTTGAACAAA
ACAAAAAGTGCCTTGTGCATGGCCTCACTACTTTGCTTCCAACACAAATTTAGAGTGTCAATCTAAATTAACTAATAAATTTGAAGTACCTTCATTATTATCCACTTCGTGTTCTTTGTG
CATAATTCAAGAGTTGTCCATATCCTAACGGGCCTTTCTCCATCAAACATGTCGTCTCTATTTTGAGCTTGATATTTAAAGCCTGATTCTTTTTTTACTAACAAATGTGACATGTTTATA
ACTTTCTCGATTAGATGCATTTCTCTTTTCCTGTATGGATTATTGATTGTCTAGATCTTCGAGGTCATTCAAGTAGACATAATTCAGGTTAATTTTAGTAAATCAAAAAGTCGGTGACTC
CCCTCTGTTAAATATTAAAGGACACGGCATGTTGCTGACCAAAAGCCTTGATTTAGAGAACACTTGAGAGCACAATCATTTTGTTTCTAGTCCGACAATTATTGGATGCATTGTTCCTAG
AGAGACAACACAAATTAAAGTCAAAAGGCATGAGAAAGAGTGTCATTTCCGTCCAAACTGGTGTCTGTGGGCGTTCATAACGGGGGACAAAAAGGGGGAATATGATAAGGGAAATTAATC
AGTGTTCATACTTTATGTTCAGGAAAAAGTTACAGCACTTGTTCTGTTTATATTTTGACCGTCGAATCTAATGAAGGCAGTAGGATTGATTTGACTGATTAACGATGTGTGGCACAAAAC
ATAATATAGGGATGCGACGCATCTGTTTTGTTGGACGACACCGCGAACTTCACTGGGGAGAAGAATGCTACCCCAAATGCCAATTCCTTGCGGGGATTTGATGTGATTGACACGATCAAG
TCCCAATTGGAGAGCGCATGCCCCGGTGTTGTGTCCTGCGCTGATCTCTTGACTGTGGCTGCCCGAGATTCCGTCGTCGCT
GTAAGCGCACACTTTCTTCTTAATTCTAGTGATCAATTG
TGATGAGAAAAAATCACTCGTTATGATCTCGATGCTGCATCAATACTCACACGTGTGGATTTGTTTAACTATTTAATTCTTAGTTAGGTGGCCCAAGTTGGACAGTCCCGCTAGGAAGAA
GAGACTCAACCACTGCAAGCCAAAGTGCTGCTAATAGCAACATCCCTGCCCCGACTTTGAACCTTAGCGGCCTCATCACTGCCTTCTCTAACAAAGGTTTCACCACCAAAGAAATGGTGG
CACTCTCAG
GTCATTGTTTTTCCTTTTTTGTGGCACCTTTTAATAACGAATTTACAATAATGTTTGATCGATATACTAAGATTAATATTAAGAAGTTGTTCGATTGTTGTTAATAGGGTC
GCACACGATAGGTCAAGCCCGATGCACAAGTTTCCGGGCCCGTCTTTACAACGAGAACAACATCAACACCACGTTCGCAACCTCGCTCAAGGCGAACTGCCCAAGCTCCGGAGGTGACAA
CAATCTCTCTCCTCTAGACACCACGAGCCCGACGTCCTTTGACAATGCCTACTTTAAGAACTTGCAAATCCAAGAAGGTCTTCTTCACTCGGACCAGCAATTGTTTAGTGGTGGTTCCAC
GGACGCTCAAGTGAACGCTTATAGCAGCAATTCAGCTACTTTCATGACAGATTTTGCTAACGCCATGGTGAAGATGGGTAACCTCAGCCCGCTCACCGGCTCAAGCGGTCAGATTAGGAA
GAACTGCAGGAATGTCAACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGGCTTGGGAGAGCTCTTCGGTCAGAACCGCCTTTTTATTGTTGCTGTCTTTCCTACTGGGAACAGCCTCAGCTCAGCTGTCCAGTACTTTCTACTCCACCTCCTGTCCCAGCGCCCTCT
CCACCATTAAATCCGCCGTGAGCTCTGCGGTCAAAAGTGAGGCCCGCATGGGCGCATCGCTGCTCCGCCTTCATTTCCACGATTGCTTCGTTAAT
GGATGCGACGCATCTGTTTTGTTGG
ACGACACCGCGAACTTCACTGGGGAGAAGAATGCTACCCCAAATGCCAATTCCTTGCGGGGATTTGATGTGATTGACACGATCAAGTCCCAATTGGAGAGCGCATGCCCCGGTGTTGTGT
CCTGCGCTGATCTCTTGACTGTGGCTGCCCGAGATTCCGTCGTCGCT
TTAGGTGGCCCAAGTTGGACAGTCCCGCTAGGAAGAAGAGACTCAACCACTGCAAGCCAAAGTGCTGCTAATA
GCAACATCCCTGCCCCGACTTTGAACCTTAGCGGCCTCATCACTGCCTTCTCTAACAAAGGTTTCACCACCAAAGAAATGGTGGCACTCTCAG
GGTCGCACACGATAGGTCAAGCCCGAT
GCACAAGTTTCCGGGCCCGTCTTTACAACGAGAACAACATCAACACCACGTTCGCAACCTCGCTCAAGGCGAACTGCCCAAGCTCCGGAGGTGACAACAATCTCTCTCCTCTAGACACCA
CGAGCCCGACGTCCTTTGACAATGCCTACTTTAAGAACTTGCAAATCCAAGAAGGTCTTCTTCACTCGGACCAGCAATTGTTTAGTGGTGGTTCCACGGACGCTCAAGTGAACGCTTATA
GCAGCAATTCAGCTACTTTCATGACAGATTTTGCTAACGCCATGGTGAAGATGGGTAACCTCAGCCCGCTCACCGGCTCAAGCGGTCAGATTAGGAAGAACTGCAGGAATGTCAACTAA

Retrieve as FASTA