Entry information : EgrPrx15
Entry ID 8193
Creation 2011-03-09 (Qiang Li)
Last sequence changes 2011-05-23 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2012-03-05 (Qiang Li)
Peroxidase information: EgrPrx15
Name EgrPrx15
Class Class III peroxidase    [Orthogroup: Prx063]
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus grandis    [TaxId: 71139 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EgrPrx15
start..stop
S start..stop
EcamPrx15 689 0 1..334 1..334
EgrPrx02 682 0 5..334 1..330
EguPrx02 681 0 5..334 1..330
EglPrx15 647 0 1..333 1..333
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 3830614..3830859 246 N° 2 3831054..3831239 186 N° 3 3831402..3831561 160 N° 4 3831817..3832229 413
join(3830614..3830859,3831054..3831239,3831402..3831561,3831817..3832229)


exon

Literature and cross-references EgrPrx15
DNA ref. Phytozome 12:   scaffold_1 (3830614..3832229)
Protein sequence: EgrPrx15
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   334
PWM (Da):   %s   37287.01  
PI (pH):   %s   7.38
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MRASMWWQLLLSALALLRSCEAHPIEAKATIKLPPPLQWHFYQNSCPDVEKYVRDQVEFYWKQDSTLAPKLIQLLYTDCFIKGCDASVLLDGPDAEKTAPQNAAILGFPLEVIDKVKEVLEQHCPGVVSCADIINLAARDAVILAGGVSYPVPTGRRDGNSSNAKLVDLPKRAVPWEKVIPYFKIRGLDLFDVTTLLGGHTLGRTNCEFIAERLYEFNNTGKPDPSMDPSFLAELRVQCPPNSTNSVYLNPDSGSSNRFSKTFYSRVLNHRAVLSIDQQIAAHKESLQIARRYDANFEDFLKMFGYSMTKLGNTWLLPGDQGEIRKNCRVVNGK

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 1, 3 introns). No prediction from Phytozome. Containing motif 'YTDC'.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGAGCATCAATGTGGTGGCAGCTGTTGCTATCGGCGCTCGCGTTGTTGCGCTCGTGCGAGGCACACCCCATCGAGGCCAAGGCTACGATCAAGCTGCCGCCGCCGCTGCAGTGGCAT
TTCTACCAGAACTCGTGCCCCGACGTCGAGAAGTACGTGAGGGACCAGGTCGAGTTCTACTGGAAGCAGGACAGCACCCTCGCTCCCAAGCTCATCCAACTTCTCTACACTGACTGCTTC
ATCAAG
GCACGTACCGTCTGTTCATTTCCTTCTTTCTGTCTCTCTCGCGATCTTGAAGTCGGCATCACTTTAATCATCGAGTTTCCGTTGCCCTATCTAAGCATGCCAAATCCTTTCACC
CGTTGGTTTAACTTCTCGAACTGGGCTTTCTAATATACCACTCTTCTGTGTACGTATGTATGGTTATGTGGATAAAACAGGGATGCGATGCGTCGGTTCTCTTGGACGGGCCAGATGCAG
AGAAAACAGCACCACAAAATGCAGCGATTCTAGGGTTTCCTCTGGAGGTGATTGACAAGGTCAAGGAAGTCCTGGAACAGCATTGTCCCGGGGTCGTCTCTTGCGCCGACATTATCAACC
TTGCCGCTAGAGATGCTGTCATTTTG
GTATGCAGCATGGTTCTCAGTTTTTCCTTTTTGAGCTGGAAAAGAGATTGTTTGGGCTGCTGCACTGATGATAATCGACGTGCTGTTAGCTTGA
GTTTTGGAGCGTTCGATATGGAAAGGAAAAAAATTAGAATTACTAATGTGATAATGATGTTGTAATAGGCTGGAGGGGTGTCGTACCCTGTTCCGACGGGGAGGAGGGACGGAAATTCGT
CCAATGCGAAGTTGGTGGACCTCCCAAAGCGCGCCGTCCCGTGGGAAAAGGTGATCCCTTACTTCAAAATAAGGGGCTTGGATTTGTTCGACGTCACTACTCTACTTG
GTACGGTCTAAC
CCTCGAATGAAAAGTGTTTATTTGACTCCGACCTCGTTACATTACCTTAAGATCTTAACCAATCCAGGCAACTCATTTAGTTCAGTGAATCACGCTGTCCCTTCTAGCTTTCATGTGATC
CGAACCAATCCTCCCAATGATCTCCTCCAAGTGCACAAAAATGGCATGCTCACGTATCATGTCGAACTCTCAATCATAACCAATTCCTCCTAACTTTTCCAAAAACAACTTAAATTTTGC
CAGGGGGGCATACACTGGGCAGGACCAACTGCGAGTTCATCGCAGAAAGACTGTACGAGTTCAACAACACTGGCAAGCCAGACCCAAGCATGGACCCATCCTTCTTGGCCGAATTGAGGG
TGCAATGCCCGCCAAACTCAACGAATTCAGTGTACCTAAATCCTGACTCAGGCTCGAGTAACAGGTTCAGCAAAACCTTCTACTCCAGGGTCCTGAACCACCGGGCCGTCCTCAGCATCG
ACCAGCAGATCGCCGCCCATAAGGAGAGCCTCCAGATTGCCCGGCGATACGATGCCAATTTTGAGGACTTCCTGAAGATGTTCGGCTATTCAATGACCAAGCTGGGGAACACCTGGCTCC
TACCAGGGGATCAGGGTGAGATTCGCAAGAATTGCCGAGTCGTGAACGGGAAATAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGAGCATCAATGTGGTGGCAGCTGTTGCTATCGGCGCTCGCGTTGTTGCGCTCGTGCGAGGCACACCCCATCGAGGCCAAGGCTACGATCAAGCTGCCGCCGCCGCTGCAGTGGCAT
TTCTACCAGAACTCGTGCCCCGACGTCGAGAAGTACGTGAGGGACCAGGTCGAGTTCTACTGGAAGCAGGACAGCACCCTCGCTCCCAAGCTCATCCAACTTCTCTACACTGACTGCTTC
ATCAAG
GGATGCGATGCGTCGGTTCTCTTGGACGGGCCAGATGCAGAGAAAACAGCACCACAAAATGCAGCGATTCTAGGGTTTCCTCTGGAGGTGATTGACAAGGTCAAGGAAGTCCTG
GAACAGCATTGTCCCGGGGTCGTCTCTTGCGCCGACATTATCAACCTTGCCGCTAGAGATGCTGTCATTTTG
GCTGGAGGGGTGTCGTACCCTGTTCCGACGGGGAGGAGGGACGGAAAT
TCGTCCAATGCGAAGTTGGTGGACCTCCCAAAGCGCGCCGTCCCGTGGGAAAAGGTGATCCCTTACTTCAAAATAAGGGGCTTGGATTTGTTCGACGTCACTACTCTACTTG
GGGGGCAT
ACACTGGGCAGGACCAACTGCGAGTTCATCGCAGAAAGACTGTACGAGTTCAACAACACTGGCAAGCCAGACCCAAGCATGGACCCATCCTTCTTGGCCGAATTGAGGGTGCAATGCCCG
CCAAACTCAACGAATTCAGTGTACCTAAATCCTGACTCAGGCTCGAGTAACAGGTTCAGCAAAACCTTCTACTCCAGGGTCCTGAACCACCGGGCCGTCCTCAGCATCGACCAGCAGATC
GCCGCCCATAAGGAGAGCCTCCAGATTGCCCGGCGATACGATGCCAATTTTGAGGACTTCCTGAAGATGTTCGGCTATTCAATGACCAAGCTGGGGAACACCTGGCTCCTACCAGGGGAT
CAGGGTGAGATTCGCAAGAATTGCCGAGTCGTGAACGGGAAATAA

Retrieve as FASTA