Entry information : MguAPx-R (mgv1a010472m)
Entry ID 8364
Creation 2011-05-06 (Christophe Dunand)
Last sequence changes 2011-05-06 (Christophe Dunand)
Sequence status complete
Reviewer Catherine Mathe
Last annotation changes 2012-01-04 (Qiang LI)
Peroxidase information: MguAPx-R (mgv1a010472m)
Name (synonym) MguAPx-R (mgv1a010472m)
Class Ascorbate peroxidase related    [Orthogroup: APx-R001]
Taxonomy Eukaryota Viridiplantae Streptophyta Phrymaceae Mimulus
Organism Mimulus guttatus    [TaxId: 4155 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value MguAPx-R
start..stop
S start..stop
SaAPx-R01 480 5e-173 1..310 1..315
IaquAPx-R01 414 2e-146 53..309 76..336
InAPx-R01 407 1e-143 53..309 78..338
VvAPx-R 400 3e-141 9..311 7..330
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 188163..188395 233 N° 2 188688..188803 116 N° 3 189032..189102 71 N° 4 189213..189255 43
N° 5 189340..189436 97 N° 6 189715..189798 84 N° 7 189901..190022 122 N° 8 190123..190189 67
N° 9 190279..190378 100  
join(188163..188395,188688..188803,189032..189102,189213..189255,189340..189436, 189715..189798,189901..190022,190123..190189,190279..190378)


exon

Literature and cross-references MguAPx-R (mgv1a010472m)
DNA ref. Phytozome 12:   scaffold_79 (188163..190378)
Cluster/Prediction ref. UniGene:   Mgu.17648
Protein sequence: MguAPx-R (mgv1a010472m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   311
PWM (Da):   %s   33438.19  
PI (pH):   %s   7.44
Sequence 353
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MRSTTAAVDPSFLGSATSFSAAWGHKFPVINLQPVKLVGKRLTVACATPPSSFGRRALIYIATTSFLMPSPSFASATDENALLQEEIGKVLSKGRAAGLLRLVFHDAGTFDDGDKTGGMNGSIIYELDRPENRGLEKSLKILEKAKVQVDAVQPVSWADLIAMAGAEAVSICGGPKIPVQLGRLDATVPDPVGKLPEETLVAATMKQVFQKKGFSTQELVALSGAHTLGTKGFGSPTVFDNSYYKILLEKPWSASGGMSDMIGLPSDRSLGEDDECIKWISKYADDQNLFFEDFKNVYVKLVNSGAKWRSM*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo ?, 8 introns) and 20 ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGAGGAGCACCACTGCCGCCGTCGATCCCTCGTTTCTCGGTTCCGCCACCTCCTTCTCCGCCGCTTGGGGCCACAAGTTCCCCGTCATAAACCTACAGCCGGTCAAATTAGTAGGGAAGA
GGCTCACAGTAGCCTGTGCTACTCCACCGTCTTCATTTGGGAGGCGAGCTCTGATTTATATAGCGACGACGTCGTTTCTCATGCCCTCTCCCAGTTTTGCCTCTGCTACTGA
GTAAGCAT
AGTCCTCCTTTGGTTGTACATATATTTTGCTCCAATTTAATTTCACTTATCTGGTTTCATAACTAGTGGCAATGCTTTTATTCAAATAAAAACCTAATCCTGTTTATCCAAATAGTACTA
TTTCAGCCAGAATTCTTTTGATTGCTGAAGATTCAATGGCATTTTCGCCATCTTTGTCGCAGTTAATTAGGCATCCACTGGATAGTATTAGCTAATTACGAATCATTTAAAACCAAATGA
TAGTTTGTGAAATGTGTTATTGACCTAATGGTTTTGGGCTCCAGTGAAAATGCTCTGTTACAAGAAGAGATCGGTAAGGTATTGTCCAAAGGCAGGGCTGCCGGTTTACTTCGTTTAGTT
TTTCACGATGCTGGCACTTTTGACGACGGTGATAAAACAG
GTATTGCATCGAGGAATCCATCTTTCTTTTCAAAGTGAAATTTTCAAAATTGCATATTTTGGGGTAATTGTAAAAGTAGG
AGTTCGTTTTCCATTACTTCAAAAATTAGACTAGCAGAATCTAATTCTTGTTTTTCTTTTCCTTAACCCTTTATGGAAGATTTGTTTCCCCTGATTTTAGATCTTGTTTATTAGCCTTTT
GATTTCCTGGTCGATTTCGTTATTTTAGGTGGTATGAATGGATCGATAATTTACGAACTTGACAGGCCTGAGAACAGGGGTCTTGAGAAGTCACTGAAGGCAAGCTCCTCATCTTCTTCG
TGTATCCCTTAATTCGATTTTTGTATGCCGTCAATTGTATCCAGTATTTTCATTCATTCCTTCCTCCTAAGTGGGTGCATTGTTCTCAGATTCTGGAGAAAGCAAAAGTACAAGTGGATG
CGGTACAACCAG
GTATTTCTTGGCAAATGGAACGATGAGAATTTACTGCTCAAGCATTAATTGTATATCATATAACTCTTCTTTGGTGCCTGTTAGTATCGTGGGCGGATTTGATTGCCA
TGGCTGGAGCGGAAGCTGTTTCAATATGTGGAGGTCCAAAGATCCCTGTTCAACTCGGAAGATTAGATGCAAC
GTAAAGTGCTCTAATCTTGTTAATCCTTGCTTGTAGTTGTTCTGATT
TTCTGGTTTCTCAGTATGTATTGATTTCTCGAGATGATTTACTCGAAAGAAGAGTCTTGAACTACTACAATCATGAAAAGATTAGTGGACAATTGTGGCATAAGAAAAATAACCACACGG
GATATATCATTAGATTTCACGTAGTACTGCTATTTGGTGACGTCTTAATGTCGTTTACAGGGTTAAAGTAAAATGAGAAAGAGTTTTTTATCACTTCACCTTGTCTTTCAGGGTGCCTGA
TCCTGTTGGGAAGCTTCCGGAAGAAACACTCGTTGCAGCTACCATGAAGCAAGTTTTTCAAAAGAAAGGCTTCTC
GTGAGTATCCATATATCATTTCCCAAAAAATAAAAAAATCACTTA
CGGTATATACATCCAATGTTTGTGCTGGAATAAATGCTAAACAAAGTTTGTATACAGAACACAGGAACTGGTTGCATTATCGGGAGCTCATACACTAGGAACCAAAGGCTTCGGAAGTCC
GACAGTCTTTGACAATTCTTACTACAAAATTCTTCTAGAGAAGCCATGGTCAGCTTCAG
GTGATTCACCGTGTTCCTTCTTCCTTTGACATCTTGTTTTTCAGGCGACCATTTTAAGAAC
TAATAACATGTAATTAATTATTTTTTATCACACATTTAGGTGGGATGTCTGATATGATTGGCCTTCCTTCGGATCGATCACTTGGTGAGGATGATGAATGCATCAAGTAAGCCATTTCCT
CACAACCCTTGTCGCTGGTATTTTTGCACTTTTGTTATTTGTATCCCGATTGATATATGTTATTGTTTTCGACAGGTGGATATCAAAGTATGCGGATGACCAGAATCTGTTTTTTGAAGA
TTTTAAGAATGTCTATGTTAAACTTGTCAATAGTGGTGCCAAGTGGAGATCTATG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGAGGAGCACCACTGCCGCCGTCGATCCCTCGTTTCTCGGTTCCGCCACCTCCTTCTCCGCCGCTTGGGGCCACAAGTTCCCCGTCATAAACCTACAGCCGGTCAAATTAGTAGGGAAGA
GGCTCACAGTAGCCTGTGCTACTCCACCGTCTTCATTTGGGAGGCGAGCTCTGATTTATATAGCGACGACGTCGTTTCTCATGCCCTCTCCCAGTTTTGCCTCTGCTACTGA
TGAAAATG
CTCTGTTACAAGAAGAGATCGGTAAGGTATTGTCCAAAGGCAGGGCTGCCGGTTTACTTCGTTTAGTTTTTCACGATGCTGGCACTTTTGACGACGGTGATAAAACAG
GTGGTATGAATG
GATCGATAATTTACGAACTTGACAGGCCTGAGAACAGGGGTCTTGAGAAGTCACTGAAG
ATTCTGGAGAAAGCAAAAGTACAAGTGGATGCGGTACAACCAGTATCGTGGGCGGATTTGA
TTGCCATGGCTGGAGCGGAAGCTGTTTCAATATGTGGAGGTCCAAAGATCCCTGTTCAACTCGGAAGATTAGATGCAAC
GGTGCCTGATCCTGTTGGGAAGCTTCCGGAAGAAACACTCG
TTGCAGCTACCATGAAGCAAGTTTTTCAAAAGAAAGGCTTCTC
AACACAGGAACTGGTTGCATTATCGGGAGCTCATACACTAGGAACCAAAGGCTTCGGAAGTCCGACAGTCTTTGACA
ATTCTTACTACAAAATTCTTCTAGAGAAGCCATGGTCAGCTTCAG
GTGGGATGTCTGATATGATTGGCCTTCCTTCGGATCGATCACTTGGTGAGGATGATGAATGCATCAAGTGGATAT
CAAAGTATGCGGATGACCAGAATCTGTTTTTTGAAGATTTTAAGAATGTCTATGTTAAACTTGTCAATAGTGGTGCCAAGTGGAGATCTATG

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
AAAAAGGTAA TAACGGTAAG AAATTAAGAA TCATTCACCA AAAATCAACC GACAACTGTT CTCACTTCTC AGCTGCTTAC TCTACTCAGC AAAGATGAGG AGCACCACTG CCGCCGTCGA  TCCCTCGTTT CTCGGTTCCG CCACCTCCTT CTCCGCCGCT TGGGGCCACA AGTTCCCCGT CATAAACCTA CAGCCGGTCA AATTAGTAGG GAAGAGGCTC ACAGTAGCCT GTGCTACTCC  ACCGTCTTCA TTTGGGAGGC GAGCTCTGAT TTATATAGCG ACGACGTCGT TTCTCATGCC CTCTCCCAGT TTTGCCTCTG CTACTGATGA AAATGCTCTG TTACAAGAAG AGATCGGTAA  GGTATTGTCC AAAGGCAGGG CTGCCGGTTT ACTTCGTTTA GTTTTTCACG ATGCTGGCAC TTTTGACGAC GGTGATAAAA CAGGTGGTAT GAATGGATCG ATAATTTACG AACTTGACAG  GCCTGAGAAC AGGGGTCTTG AGAAGTCACT GAAGATTCTG GAGAAAGCAA AAGTACAAGT GGATGCGGTA CAACCAGTAT CGTGGGCGGA TTTGATTGCC ATGGCTGGAG CGGAAGCTGT  TTCAATATGT GGAGGTCCAA AGATCCCTGT TCAACTCGGA AGATTAGATG CAACGGTGCC TGATCCTGTT GGGAAGCTTC CGGAAGAAAC ACTCGTTGCA GCTACCATGA AGCAAGTTTT  TCAAAAGAAA GGCTTCTCAA CACAGGAACT GGTTGCATTA TCGGGAGCTC ATACACTAGG AACCAAAGGC TTCGGAAGTC CGACAGTCTT TGACAATTCT TACTACAAAA TTCTTCTAGA  GAAGCCATGG TCAGCTTCAG GTGGGATGTC TGATATGATT GGCCTTCCTT CGGATCGATC ACTTGGTGAG GATGATGAAT GCATCAAGTG GATATCAAAG TATGCGGATG ACCAGAATCT  GTTTTTTGAA GATTTTAAGA ATGTCTATGT TAAACTTGTC AATAGTGGTG CCAAGTGGAG ATCTATGTGA TTCATGGAAA GCATCGGTCG TCGCTCGTGT TAAAAACATG GTACTATGGT 
CCATTCTAAA TAATTCGGAT ATATGTCCAA AACCTCGTGG CCTATTTCTT TCACTGTATT TTTTCTCTCA TTCATAATAA GGGAAATTTA TGACCATCT 

Retrieve as FASTA