Entry information : SiAPx-R (Si014032m)
Entry ID 8369
Creation 2011-05-09 (Christophe Dunand)
Last sequence changes 2011-05-09 (Christophe Dunand)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2011-12-15 (Qiang Li)
Peroxidase information: SiAPx-R (Si014032m)
Name (synonym) SiAPx-R (Si014032m)
Class Ascorbate peroxidase related    [Orthogroup: APx-R001]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Setaria
Organism Setaria italica    [TaxId: 4555 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SiAPx-R
start..stop
S start..stop
SbAPx-R 554 0 1..334 1..333
ZmAPx-R 522 0 1..334 1..337
ObrAPx-R 511 0 1..334 1..331
BdiAPx-R 500 3e-180 1..334 1..329
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 32837945..32838027 83 N° 2 32838117..32838229 113 N° 3 32838422..32838512 91 N° 4 32838793..32838920 128
N° 5 32839112..32839182 71 N° 6 32839313..32839355 43 N° 7 32839445..32839541 97 N° 8 32839673..32839756 84
N° 9 32839958..32840082 125 N° 10 32840238..32840304 67 N° 11 32840501..32840603 103  
join(32837945..32838027,32838117..32838229,32838422..32838512,32838793..32838920 ,32839112..32839182,32839313..32839355,32839445..32839541,32839673..32839756,328 39958..32840082,32840238..32840304,32840501..32840603)


exon

Literature and cross-references SiAPx-R (Si014032m)
DNA ref. Phytozome 12:   scaffold_6 (32837945..32840603)
Protein sequence: SiAPx-R (Si014032m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   334
PWM (Da):   %s   36023.18  
PI (pH):   %s   6.16
Sequence 376
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MELTSIPYLASSSSSSFFYSSYSRCTCRGKRDGKLVITASAAGGRCAADLACSQLFEQENEDALSGSRSSWHYRRREFASAILLPFLLPHIDISSAAETYNGSVIRSGVRNVLTKAKAAGVLRLVFHDAGTFDVSEKSGGMNGSIIYEVDRPENTGLSRSIKILGKAKAGIDDIQKVSWADLIAVAGAEAVALCGGPEIPVRLGRLDSSTADPAGKLPEETLDAAALKTLFSTKGFSTQEMVALSGAHTIGGKGFGSPIVFDNSYFKVLLEKKPQTSSSGMEAMVGLRTDWALTEDEECLRWIRIYAEDQARFFDDFRDTYIKLVDSGATWRAA*

Retrieve as FASTA  
Remarks Complete sequence from genomic. No EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGGAGCTAACCAGCATCCCCTACCTTGCATCATCTTCCTCCTCCAGCTTCTTCTACTCTAGCTACAGTCGCTGTACCTGCAGGTGATGCTAGCAACCTCTCTCATTTCTTATGCAAATGA
TTCATTCATGTGTACATGGAAACAAATAACCTTAGAAATCATGATGTGCAGGGGTAAAAGAGATGGGAAGCTGGTGATAACAGCTTCTGCTGCTGGTGGTAGGTGTGCTGCTGATTTGGC
ATGTTCACAACTCTTTGAGCAGGAAAATGAAGATGCCCTTTCAG
GTACATCGCAGTTGTTATGTTTTGCATTTGAGTTAGATGGGTATATGTCTCCTGGTTCCAAATCATTTCAATGAAC
TCAATCTGTAAGTGTCTGATTGATGTCAGTGGAACATTTTTTTTGTTGCTTAGGGAGAATCCACACCACGAAAATCAGTATGGTCAACTAAAATTTTCTTTGTATCTTGGCTCCAGGTTC
TAGATCTTCCTGGCATTATAGAAGGAGAGAGTTTGCTTCTGCCATTTTGCTCCCTTTTCTGCTTCCTCATATTGACATTTCGAGCGC
GTAAGTGCATTATGCAACTACCTTCCTGTTTGT
ATTATATCACTGAATTTCCATAGTTATTCTGTTCTTAAAGTTTTTAACAGAAATTCATAAGAGCTTCTTATTGATGTTTCAAATGGTAAACATTGTGCGAACATCAGTTTAGAAGAAGTA
TGTAGAGCCATCGATGAATCTAGTATACGGTGATCCGTAGAAAAGAAACCATCCTCAAAGCTGTTTCTTGCTCCTAAAACAATAGTGTGATATCTATAAGAGAAGTTGATTGTAGTTATT
TTCTCAGGGCTGAGACATACAATGGATCAGTCATTCGAAGTGGTGTAAGGAATGTTTTAACCAAGGCCAAGGCTGCTGGTGTGCTTCGTTTGGTTTTCCATGATGCAGGGACTTTTGATG
TTAGTGAGAAATCAG
GTTAGCTTTCTTGATATCTCTACTGATATAAGGCTGACATAGCACCCTATCAAATTCTTTTGGAGTAAAAAGATGATGGATAAAATTGTTGAGATTAAAATATTA
GCTCCTGAGCAAGGTTGAATATATGTAAAAGAAAATAGAAAATGTAAATGTAATATGATGTGTATGTTGATATCAGTATCTTTCAGGTGGCATGAATGGCTCTATAATTTATGAAGTTGA
CAGACCTGAAAATACTGGGCTAAGTAGATCCATAAAG
GTTTACCCTCTTGAGAGTGTTTTTCAGACAAGCACGATCCTTTTTTTCGAGTGCCTTATATAATGTGATATTTATTGAGGAAT
ACTATGTTACCATCTTATGGCTTCTTAATTGCTTCATAACTGAACAGATATTAGGAAAAGCAAAAGCAGGAATCGATGATATACAGAAAGGTATTTAAATTCACATCGCTTGCAGCTTTG
CTTCCTGTATGAAACTTCAGTTTTCACTTTGTCAAATTTACTGATGCATTTGCTGATAGTGTCATGGGCGGACTTGATTGCTGTGGCTGGTGCTGAGGCAGTTGCGCTCTGTGGTGGGCC
TGAAATTCCAGTAAGGCTAGGACGATTAGATTCCAG
GTGCAACATCGTAATCATTTTTTATTGAACAATTCTTTGCAAATTGCATTGTTAAGAAAAAAGTTATTCTAGATTGCTTTTCTG
TTCTGTTTTCTCCTTAGTTTTCTGAAAGAGCATATTTCTTTTTGAAGTACTGCTGATCCTGCTGGTAAACTTCCTGAAGAGACATTGGATGCAGCTGCCCTAAAAACATTATTCAGCACA
AAGGGTTTTTC
GTGAGTTCTTGTTTCCTTATATGGTGCATATTTTATGGATTTCAGTTCTTCATTTTGGAATTCAAATCAGTATAGCTCATCACCTCACACCTGGTGATATTTGGGCAAT
TTTTCTATTTATTCCCTGAGACTTTGGGGAATTGTTTCATAACGTAAGCTGGTGTTACATCGATGCCTGAAGTTATATTTGGTACTTAACAGGACGCAGGAAATGGTTGCTTTATCTGGA
GCACACACAATTGGAGGCAAAGGATTCGGGAGTCCAATCGTTTTCGATAACTCCTATTTCAAAGTGCTCCTTGAGAAGAAGCCACAAACATCTTCAT
GTAAGTGCATGTGGTTATCTTCA
TGCCTTTGTCTAGTCGCCACATTTTCCTGACACATCGTTTCCATCTTCCCTGGAATCTTAGGAGACAACTTATCCATTGAAATTCATCTGAAGTTTAAGCTTATCAAAACTTACTGTGTT
GTCTTTGTAAAGCTGGCATGGAAGCAATGGTGGGGCTGCGCACGGATTGGGCACTCACTGAAGATGAAGAGTGCTTAAGGTTGGCTCTAAGTTAGATCAGCATTAATTGACATTGCATCT
GTTTTTCATGGAATAGTTCGACTATATTGGTTATCTTGTCCGCCATAAGCTAACATGTCCAGCTTGAATAACGAAATAATTTGGCTTTAGGGCTAATGCTTGGGAAATGTTAAATGCTTC
GTCTGCTTATTGATATTGCACATTTGCATCTGCAGATGGATCAGGATCTATGCAGAGGACCAAGCTAGATTTTTCGACGACTTCAGGGATACATACATCAAGCTTGTAGATAGTGGAGCC
ACGTGGAGAGCAGCTTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGGAGCTAACCAGCATCCCCTACCTTGCATCATCTTCCTCCTCCAGCTTCTTCTACTCTAGCTACAGTCGCTGTACCTGCAGGGGTAAAAGAGATGGGAAGCTGGTGATAACAGCTTCTG
CTGCTGGTGGTAGGTGTGCTGCTGATTTGGCATGTTCACAACTCTTTGAGCAGGAAAATGAAGATGCCCTTTCAG
GTTCTAGATCTTCCTGGCATTATAGAAGGAGAGAGTTTGCTTCTG
CCATTTTGCTCCCTTTTCTGCTTCCTCATATTGACATTTCGAGCGC
GGCTGAGACATACAATGGATCAGTCATTCGAAGTGGTGTAAGGAATGTTTTAACCAAGGCCAAGGCTGCTGGTG
TGCTTCGTTTGGTTTTCCATGATGCAGGGACTTTTGATGTTAGTGAGAAATCAG
GTGGCATGAATGGCTCTATAATTTATGAAGTTGACAGACCTGAAAATACTGGGCTAAGTAGATCCA
TAAAG
ATATTAGGAAAAGCAAAAGCAGGAATCGATGATATACAGAAAGTGTCATGGGCGGACTTGATTGCTGTGGCTGGTGCTGAGGCAGTTGCGCTCTGTGGTGGGCCTGAAATTCCAG
TAAGGCTAGGACGATTAGATTCCAG
TACTGCTGATCCTGCTGGTAAACTTCCTGAAGAGACATTGGATGCAGCTGCCCTAAAAACATTATTCAGCACAAAGGGTTTTTCGACGCAGGAAA
TGGTTGCTTTATCTGGAGCACACACAATTGGAGGCAAAGGATTCGGGAGTCCAATCGTTTTCGATAACTCCTATTTCAAAGTGCTCCTTGAGAAGAAGCCACAAACATCTTCAT
CTGGCA
TGGAAGCAATGGTGGGGCTGCGCACGGATTGGGCACTCACTGAAGATGAAGAGTGCTTAAG
ATGGATCAGGATCTATGCAGAGGACCAAGCTAGATTTTTCGACGACTTCAGGGATACAT
ACATCAAGCTTGTAGATAGTGGAGCCACGTGGAGAGCAGCTTAA

Retrieve as FASTA