Entry information : VcaCP01
Entry ID 8373
Creation 2011-05-12 (Christophe Dunand)
Last sequence changes 2011-05-12 (Christophe Dunand)
Sequence status complete
Reviewer Marcel Zamocky
Last annotation changes 2012-01-18 (Christophe Dunand)
Peroxidase information: VcaCP01
Name VcaCP01
Class Catalase peroxidase    [Orthogroup: CP002]
Taxonomy Eukaryota Viridiplantae Chlorophyta Chlorophyceae Volvocaceae Volvox
Organism Volvox carteri    [TaxId: 3067 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value VcaCP01
start..stop
S start..stop
CreCP01 801 0 25..708 21..729
PulCP01 743 0 25..701 25..686
PsojCP 741 0 7..701 5..683
PiCP01 736 0 7..700 8..685
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 623660..623805 146 N° 2 624287..624496 210 N° 3 624684..624954 271 N° 4 625278..625391 114
N° 5 625814..625877 64 N° 6 626112..626281 170 N° 7 626556..627109 554 N° 8 627463..627654 192
N° 9 627905..628064 160 N° 10 628383..628523 141 N° 11 628759..628869 111  
join(623660..623805,624287..624496,624684..624954,625278..625391,625814..625877, 626112..626281,626556..627109,627463..627654,627905..628064,628383..628523,62875 9..628869)


exon

Literature and cross-references VcaCP01
Literature Prochnik S., Umen J., Nedelcu A.M., Hallmann A., Miller S.M., Nishii I., Ferris P., Kuo Al. Mitros T. et al. (2010) Genomic Analysis of Organismal Complexity in the Multicellular Green Alga Volvox carteri. Science 329:223-226.
Protein ref. UniProtKB:   D8UCP0 [Incorrect prediction]
DNA ref. Phytozome 12:   scaffold_60 (623660..628869)
Cluster/Prediction ref. UniGene:   Vca.1617 [5' end]   Vca.1438 [3' end]
Protein sequence: VcaCP01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   711 (691)
PWM (Da):   %s   77173.99 (75116.9)  
PI (pH):   %s   5.33 (5.22) Peptide Signal:   %s   cut: 20 range:20-710
Sequence 752
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAAPRFLCAVLISILATQAIQVAAKCPFHFGRARMDDDVGAILQAEPRRMLTSADVKAVNELNLDAVKADLKALFLDSKDWWPADFGNYGPLMIRMAWHCAGSYRTSDGRGGCDGARQRFDPERSWADNTSLDKARKLLWPIKEKYGSALSWGDLMILAGNTAIESMGGPILGFCAGRIDDADGSASEPLGPSLDQEMVAPCSVNGECEAPLGASTMELIYVNPEGPLGNPVPELSAPQIRDIFGRMAMNDSETVALVGGGHAFGKCHGACPTGPGPSPRQQPWDPWPGTCGNGTMKGKGENTFTSGFDGPWTTQPTKWDNEYYQNLLKYDWEVYMGPGGHHQWRPVKKDPSDPEELPDIIMLTADVALTRDPAYLEIVKLYASDLGALERAFSHAWYKLTTRDMGPYTRCLGSQVPPPQPFQAPLPPPPATLPDFKAVSKAIAKALRTASPALEGDLVGGKPYYGALFANLAYQCACSFRQTDYTGGCNGARIRFSPQKDWPNNVAMDRVLAVLEPIKASFPTLTYSDLIVLAGSNALTDAKAKGIRFCPGRSDADPNEPPAPVYPPRTMNNKIAQLMDNGIVMGLDMREMVAIQARLRSPSQQRRLGFSGSWTNDASKLTNEYFRVLLDNDWVNVTSSAGQLEMKAVGKEGIYMTPTDLAIKWDAVLSAIAQEFATDATAFYTAFASAWNKMMIADRFKGPTANECPS*

Retrieve as FASTA  
Remarks Complete sequence from genomic (10 introns) and 24 ESTs. Incorrect splicing prediction from Phytozome => confirmed with EST (FD830641.1).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGGCGGCACCAAGATTTCTTTGCGCTGTATTGATCTCAATACTAGCGACGCAAGCAATCCAGGTGGCTGCGAAGTGTCCCTTTCACTTCGGCCGGGCCCGTATGGACGACGATGTCGGTG
CTATCCTCCAGGCGGAACCGCGCAG
GCAGGTGCTTGCTAACCTGTTGGCTTTCTGTTCTACTGTAAATGTCCATTGGATGCCTCATTCGGAGGCTCAAGGCCCTGTACTGCGTTTGCAGC
AATGCCGAGCGTAGCGGCTTTTATAGCGAGCACCAAGATCACCATACCCAACAGATATTAAACGAGATTTGTTGTTTTTTGAGCTTAGGAGAGCAGTTCGAATGCTACCGAGGCTCGGTT
TCAGTTTCCCATAGGAGTTGGCGCCGTCCCAGATATCCGATCCACATGAACCTGAACTGAATCAATGGAGAATTTCACTTCCATCTGTCAATTATCCCGCGATTTCATTTGTATTGTTAC
TTATTCCGCGACATATGCTTTCGCAATCGTAACCTGCCGACATTCACGTGTTCTGTCGCAATAAATTGACCCCTTCTTTTCACGTAGGCTCCAATACTGGCATCTTCCTAATCTTATAAT
GAATCCATTCTGCCCTTTCCTCCCAGGATGCTGACATCTGCTGATGTCAAAGCTGTGAATGAGCTCAACCTTGACGCTGTCAAGGCAGACCTGAAAGCTCTCTTTCTTGATTCGAAGGAC
TGGTGGCCAGCAGATTTTGGAAACTACGGACCTCTCATGATCCGCATGGCTTGGCACTGCGCCGGCTCGTATCGCACGTCGGATGGCCGTGGCGGCTGTGATGGTGCTCGGCAAAG
GTAT
GCGGAGACCTCCAGCCCTTGAATGCATGCACTTTAAGTGCGAAGTCATGAAATATATATTCTATGAGATTGTTATTATAACAGAAACATTTCTAGCCATAAACTGTATTGAAGTTCGACT
CGACCATCGACTTTACAAGCCCATATCGACAGTTATCGGAATGTTTCTTTTCCACATCTACAGGTTCGATCCCGAGCGTTCCTGGGCCGACAACACGAGTCTGGACAAGGCCCGCAAGCT
GCTATGGCCCATCAAGGAGAAGTACGGCAGTGCGCTTTCCTGGGGTGACCTCATGATCCTCGCGGGTAACACGGCCATTGAGTCTATGGGCGGCCCCATCCTGGGCTTCTGCGCGGGCCG
CATCGACGACGCGGACGGCAGCGCCTCCGAACCCCTGGGCCCCTCCCTGGATCAGGAAATGGTCGCTCCCTGCTCCGTAAATGGGGAGTGCGAG
GTGAGTGCCACATCGACATGGACCCC
ACCAATTTCCCTGTCCATTTGTAACGTTGCAAACCGGACGAAGGTACTCGTGCCGTAACGATACTTCAGCTTCCGACCTCCCATTAGGGGGGTCAGTCCTCTGCTCTGCTCGCCACCTAG
GCAGAAGTAACACCAAAAAGAAGACTGTGCACCTCATGTAATAAATGGTATATAATAAACCATCAAATAAATAAACTGCTTGTTTACGACAGTTTCTTATCCCAGCAAGATAAGACCTTG
TTGTGGCGTTCGGGCTTCAGTTTAGTTGCCTCCTTCCGTACTCCTCTCTCTCGCCAGGCGCCCCTCGGCGCCTCCACCATGGAGCTCATCTACGTCAACCCCGAGGGCCCCCTGGGCAAC
CCGGTTCCGGAGCTGAGTGCGCCCCAAATTCGGGATATCTTCGGTCGCATG
GTGGGTCGTACGGATCATCACGTGCTAGTAGTAAGTCCGTAGCGGGAAGTAAAAAAGCTGATCGTTTTG
CTGCGGTCGCTGAGGTACGGTGCTCTGGTTGTGGCAGATGACGCCATATCTGCATGTCAATGTGAATATCCCAACTGGCCATGCATGCTTCCTCTTACTGCATGACGTTTTGAAATCTGG
CGCTGACAGCTTTGGATACGTATTGTGGTGTAGATCGCAGCATCTACATAGCTGAGCTAAAAATTGGAAAATATTGCCGCAGTCCGCTGTGTTTACATGATGCTGCTGGATTTCTTGTAC
GCTTTCTTGGCGCCAACCACTCCCCGCAATGAACGACACCACAACGATACCCAACCCACATCACTCCGTACCTTGCCCTGCCGTACCGTACCGTGCCGTATCGTTCGGCACAGGCTATGA
ACGACTCTGAGACGGTGGCGCTGGTTGGCGGCGGACACGCCTTCGGCAAGTGCCACG
GTGCGTCTTGTTGGAGGGGGGGGTGGGTGGGGCTCGCAACGTGAGCTGCGTGTACCTCTCGTC
ATGTACCTCGTCCCTGGTAACCTTGCTAGCCTCGGTCTGCTTGCTGTCCCCCAAACGACCTCACCAACTGCCTGTCCTTCCTAGTTTTAATTATTTGGCTTCATATGAATGATCGATCGA
TCGATCAAGGCCAATTGTGACCTGAGCTCCCGTCCCGTTCCGTACCTTCAGGCGCCTGCCCGACTGGCCCCGGCCCCAGCCCCCGACAGCAGCCTTGGGACCCGTGGCCCGGCACCTGCG
GCAACGGCACTATGAAGGGCAAGGGCGAGAACACCTTCACCAGCGGCTTCGACGGCCCCTGGACCACCCAGCCTACCAAGTGGGACAACGAATACTACCAG
GTGGGCCGGAAAGTGGTGG
CGTTGAAAGACCATGAGGAGATGCATCTGGAGATCACATCTAGGGTGGTTTGGGCAGTTGGCGGCATGTATGGATGCATGCGGGCAGGCAGTGGGGGCGGAAGGCTCCGATCAAACGTTT
CTCAAATTAGAATACAATGCCATGCCGACCATCCATCACTGCGTGTGTGTGTGTGTGTTTGCGTGTTTGTGTGTGTGTGTGTGTTTGCGTGTTTGTGTGTGTGTGTGTGTGTTTTTATGG
CATCCGTATTCACAGAACCTGCTCAAGTATGACTGGGAGGTGTACATGGGCCCCGGAGGCCACCACCAGTGGCGCCCCGTCAAGAAGGACCCCTCTGACCCGGAGGAGCTGCCGGACATC
ATCATGCTCACGGCGGACGTCGCCCTCACCCGGGACCCGGCCTACCTCGAGATCGTCAAGCTCTACGCCTCCGACTTGGGCGCCCTGGAGCGCGCATTCAGCCATGCGTGGTACAAGCTC
ACGACCCGCGATATGGGCCCATACACGCGCTGCCTGGGCAGTCAGGTGCCTCCGCCGCAGCCCTTCCAGGCGCCCCTGCCGCCGCCGCCAGCAACACTGCCCGACTTCAAGGCCGTGTCC
AAGGCCATTGCCAAGGCCCTGCGTACTGCCAGCCCGGCGCTGGAAGGCGACTTGGTGGGCGGCAAGCCGTACTACGGCGCGCTGTTCGCCAACCTGGCGTATCAGTGTGCGTGCAGCTTC
CGCCAGACGGATTACACTGGCGGCTGCAACGGTGCGCGCATCCGGTTCTCTCCGCAGAAGGACTGGCCCAACAACGTGGCCATGGACAG
GTGCGTGCGTGAGAGGAGGAGGAGGAGGCGC
CTCACTGCACCTGCGAGATGGATGGGCGGGACAGGGGGCGCGTGAGACGGAATTGCACGTTGTGCTACGACCTGATGAGCGTCCTGACTTGTGACAGTGATAGGTTTGGAGCCTTTTATA
AAAAAAGGTGAACGGGCCCCGTAGTCGCATGTGGCCATGTGTGGGTGTATGTGGGGGGTGTTGGGTGGCCTTTGGCATCTCGAGGGGCCTTATAAACCGGCGCGCCGTATTACTAGAACC
TGCCCAAGCCCAAGCCCAAGCGGAGTCAACAACCAACTAATAACCGAAATGGACCAACGAACCGACATTTGTGTGCTCGCAGGGTGTTGGCAGTTTTGGAGCCGATCAAGGCCAGCTTCC
CCACTCTGACGTACTCGGACCTCATCGTGCTGGCCGGCAGTAACGCCCTCACGGATGCGAAGGCCAAGGGCATCCGGTTCTGCCCGGGCCGCTCCGATGCCGACCCCAACGAGCCGCCCG
CACCCGTCTATCCGCCACGTACCATGAATAACAA
GTGAGGAGGCGGGCATGGCGGGAAATTTGGGGAATATATGGCCGTCTGTGTGTATGTGTGTGTGTGTGTGCGTGTGTGTGTGCGTG
TGTGGCTTAAGGGTTAGGGGCGTGCGATCAGGGGCTGGGGCTTTTGCCAGGTTTGAAGGCAGGAATGTGGGGGTTTTGGTGACACGTGGTCATTTCAGCTGGGCACTTCACTCACCCGCC
CGCCGATCCGACGACCCGCAATCATACACCGCCAATGTGTGCAGGATTGCGCAGTTGATGGACAACGGCATTGTGATGGGTCTTGATATGCGTGAGATGGTGGCCATCCAGGCCCGACTG
CGCAGCCCCTCTCAGCAGCGCCGCCTGGGCTTCAGCGGCAGCTGGACCAACGACGCCTCCAAGCTCACCAACGAGTACTTCCGG
GTGGGTGGGAGGTGCGCGCGGGTCTGTCCGCGTTCC
CGTAGGCGCCGCAATGCACTGCGAACACTTAGCACTTTCTACGTGTGCTACATTTAATATTTATAATCCGTACGAATGGCTGAATTTATTCACCTAGAATTCGTTGTGAGTGGGATACGG
GAAGGAGGTACACGTACAATAATACTTGGTTTGCGGCCATTGATTTTATTTATTGCTTTTGCTGCTTCTGCTGCTGCTCCAGCCACCTGCCACCTGCCGCTCGTCTACACCCTCGTCTGC
TCTCCCACCGCCTCCTTCGCGCTCTCCGCCCGCCCTGTGCAGGTGCTGCTGGATAACGACTGGGTGAACGTGACCTCGTCTGCCGGTCAACTGGAGATGAAGGCTGTCGGCAAGGAGGGC
ATCTACATGACACCAACCGACCTGGCAATCAAGTGGGATGCCGTACTGTCCGCCATCGCGCAG
GTAAACCATCGATGACTCCAGGGCCGTGGGCAGCACAACGTTGTGAGGGGGTTGCGC
TGACGGCGAATATGCGGGAAGGAATGCCTTGAGAAAACGTTGTTGTACGGTTTGTGATAGCGAGCGCGACGCGCTGATGCATGGTCTGACCGGAAAGGATGATCGCGATTGTTCCGCAAC
TAGCTTAACTATAATTAGTTTAATTATTAACGGTAATATTCTGTCAAATCCCGCGCAGGAGTTCGCGACTGATGCCACGGCCTTCTACACTGCCTTTGCATCCGCCTGGAACAAGATGAT
GATTGCCGATCGGTTTAAGGGTCCCACCGCCAACGAGTGTCCGTCTTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGGCGGCACCAAGATTTCTTTGCGCTGTATTGATCTCAATACTAGCGACGCAAGCAATCCAGGTGGCTGCGAAGTGTCCCTTTCACTTCGGCCGGGCCCGTATGGACGACGATGTCGGTG
CTATCCTCCAGGCGGAACCGCGCAG
GATGCTGACATCTGCTGATGTCAAAGCTGTGAATGAGCTCAACCTTGACGCTGTCAAGGCAGACCTGAAAGCTCTCTTTCTTGATTCGAAGGACT
GGTGGCCAGCAGATTTTGGAAACTACGGACCTCTCATGATCCGCATGGCTTGGCACTGCGCCGGCTCGTATCGCACGTCGGATGGCCGTGGCGGCTGTGATGGTGCTCGGCAAAG
GTTCG
ATCCCGAGCGTTCCTGGGCCGACAACACGAGTCTGGACAAGGCCCGCAAGCTGCTATGGCCCATCAAGGAGAAGTACGGCAGTGCGCTTTCCTGGGGTGACCTCATGATCCTCGCGGGTA
ACACGGCCATTGAGTCTATGGGCGGCCCCATCCTGGGCTTCTGCGCGGGCCGCATCGACGACGCGGACGGCAGCGCCTCCGAACCCCTGGGCCCCTCCCTGGATCAGGAAATGGTCGCTC
CCTGCTCCGTAAATGGGGAGTGCGAG
GCGCCCCTCGGCGCCTCCACCATGGAGCTCATCTACGTCAACCCCGAGGGCCCCCTGGGCAACCCGGTTCCGGAGCTGAGTGCGCCCCAAATTC
GGGATATCTTCGGTCGCATG
GCTATGAACGACTCTGAGACGGTGGCGCTGGTTGGCGGCGGACACGCCTTCGGCAAGTGCCACGGCGCCTGCCCGACTGGCCCCGGCCCCAGCCCCCGAC
AGCAGCCTTGGGACCCGTGGCCCGGCACCTGCGGCAACGGCACTATGAAGGGCAAGGGCGAGAACACCTTCACCAGCGGCTTCGACGGCCCCTGGACCACCCAGCCTACCAAGTGGGACA
ACGAATACTACCAG
AACCTGCTCAAGTATGACTGGGAGGTGTACATGGGCCCCGGAGGCCACCACCAGTGGCGCCCCGTCAAGAAGGACCCCTCTGACCCGGAGGAGCTGCCGGACATCA
TCATGCTCACGGCGGACGTCGCCCTCACCCGGGACCCGGCCTACCTCGAGATCGTCAAGCTCTACGCCTCCGACTTGGGCGCCCTGGAGCGCGCATTCAGCCATGCGTGGTACAAGCTCA
CGACCCGCGATATGGGCCCATACACGCGCTGCCTGGGCAGTCAGGTGCCTCCGCCGCAGCCCTTCCAGGCGCCCCTGCCGCCGCCGCCAGCAACACTGCCCGACTTCAAGGCCGTGTCCA
AGGCCATTGCCAAGGCCCTGCGTACTGCCAGCCCGGCGCTGGAAGGCGACTTGGTGGGCGGCAAGCCGTACTACGGCGCGCTGTTCGCCAACCTGGCGTATCAGTGTGCGTGCAGCTTCC
GCCAGACGGATTACACTGGCGGCTGCAACGGTGCGCGCATCCGGTTCTCTCCGCAGAAGGACTGGCCCAACAACGTGGCCATGGACAG
GGTGTTGGCAGTTTTGGAGCCGATCAAGGCCA
GCTTCCCCACTCTGACGTACTCGGACCTCATCGTGCTGGCCGGCAGTAACGCCCTCACGGATGCGAAGGCCAAGGGCATCCGGTTCTGCCCGGGCCGCTCCGATGCCGACCCCAACGAGC
CGCCCGCACCCGTCTATCCGCCACGTACCATGAATAACAA
GATTGCGCAGTTGATGGACAACGGCATTGTGATGGGTCTTGATATGCGTGAGATGGTGGCCATCCAGGCCCGACTGCGCA
GCCCCTCTCAGCAGCGCCGCCTGGGCTTCAGCGGCAGCTGGACCAACGACGCCTCCAAGCTCACCAACGAGTACTTCCGG
GTGCTGCTGGATAACGACTGGGTGAACGTGACCTCGTCTG
CCGGTCAACTGGAGATGAAGGCTGTCGGCAAGGAGGGCATCTACATGACACCAACCGACCTGGCAATCAAGTGGGATGCCGTACTGTCCGCCATCGCGCAG
GAGTTCGCGACTGATGCCA
CGGCCTTCTACACTGCCTTTGCATCCGCCTGGAACAAGATGATGATTGCCGATCGGTTTAAGGGTCCCACCGCCAACGAGTGTCCGTCTTGA

Retrieve as FASTA