Entry information : GgrCP02 (GgrKatG2)
Entry ID 8380
Creation 2011-05-13 (Christophe Dunand)
Last sequence changes 2011-05-20 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2011-05-20 (Christophe Dunand)
Peroxidase information: GgrCP02 (GgrKatG2)
Name (synonym) GgrCP02 (GgrKatG2)
Class Catalase peroxidase    [Orthogroup: CP001]
Taxonomy Eukaryota Fungi Ascomycota Sordariomycetes Magnaporthaceae Gaeumannomyces
Organism Gaeumannomyces graminis    [TaxId: 29850 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value GgrCP02
start..stop
S start..stop
VaaCP02 1157 0 2..772 6..772
VdaCP02 1149 0 2..772 6..772
MgrCP02 1093 0 1..775 9..785
CgloCP01_ST23 1087 0 2..775 5..777
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 20195..20477 283 N° 2 20550..20704 155 N° 3 20767..20839 73 N° 4 20897..21464 568
N° 5 21533..22796 1264  
join(20195..20477,20550..20704,20767..20839,20897..21464,21533..22796)


exon

Literature and cross-references GgrCP02 (GgrKatG2)
DNA ref. GenBank:   ADBI01000380.1 (20195..22796)
Protein sequence: GgrCP02 (GgrKatG2)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   780 (765)
PWM (Da):   %s   84420.39 (82995.6)  
PI (pH):   %s   7.07 (7.08) Peptide Signal:   %s   cut: 16 range:16-780
Sequence 821
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MLAGCLLTAAPLAQASPSCPFSQQQAREVPKSGSPAAATPFGRCPQNSNMAGGGTRSTDWWPCQLRLDVLRQFAPQTNPLGDDFDYTEAFKSLDYNALKKDLTELMTKSQEWWPADFGHYGGLFIRMAWHSAGTYRAMDGRGGGGMGQQRFAPLNSWPDNENLDKARMLIWPIKQKYGNAISWSDLMLLAGNVALESMGFKTLGFGAGRADTFQSDEGIYWGAETTFVPKGNDVRYNGSVDARGRAANLEKPLAATHMGLIYVNPEGPDGNSKPEDSALDIRTAFARMGMNDEETVALIAGGHAFGKAHGAVPGGDNIGPEPEANDMGMGLGWINKVNKGNGPDTRTSGLEVVWTKTPTKWSNGFLESLYGNQWQLVTGPGGAKHWEAVNGTVDYPDPFDKTKFRKATMLTSDLALIRDPAYAKITKRWLDNPQELNVAFAKAWFKLLHRDMGPRSRYLGPEVPKEEFLWQDPVPAVNPYGISDADVVSLKQLVLAAPGLTVSNLVSTAWASASTFRHSDKRGGANGARIALQPQRTWAVNNPKELDTVLNALKAVQTDFNSKGGKQVSLADLIVLGGSAAVERAAHEAGLPNISVPFSAGRTDATQQQTDVESFRLMEPVADGFRNFGRGNSRSLTEEILVDRASQLALTPPQLTALVGGLRVLGTNSDGSKTGVLTAQPGKLTNDYFVNLLDINTVWKPASAGDKEVWKGTDRASGAEKFTATRADLVFGSHAELRAITEVYAQKDSGERFVRDFVKAWVKVMNADRFDLGSKFASKK

Retrieve as FASTA  
Remarks Complete sequence from genomic (4 introns). No EST available.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGCTGGCCGGCTGTCTGTTGACAGCCGCGCCCCTCGCCCAGGCCAGCCCCTCGTGCCCCTTCTCGCAGCAGCAAGCGCGCGAGGTTCCCAAGAGCGGCAGCCCTGCCGCCGCAACGCCCT
TTGGCCGCTGCCCACAGAACAGCAACATGGCCGGCGGCGGCACCCGCAGCACCGACTGGTGGCCGTGCCAGCTGAGGCTCGACGTCCTGCGCCAGTTCGCGCCCCAGACGAACCCCCTGG
GTGACGACTTTGACTACACAGAAGCCTTCAAGTCCCTCGATT
GTGAGTACCTGTCTGCTTTTTCTTTCCTCTCCCGGAACGCCTTTGGGGCATGTATCCTAACACACGCTGCAGACAATG
CGCTCAAGAAGGACCTTACGGAGCTCATGACCAAGTCCCAGGAATGGTGGCCCGCCGACTTTGGCCACTATGGCGGTCTGTTTATTCGGATGGCTTGGCATAGCGCTGGCACATATCGCG
CTATGGATGGTCGTGGCGGTGGCGGAATG
GTGAGCTTAGCCGCACTTTTCAGCCCCCCTCCGTCGGGGCATCAGCTAACGTGCGCTTGTAGGGTCAACAACGGTTTGCTCCGCTGAACAG
CTGGCCCGACAACGAAAACCTCGACAAGGCTCGCATGTTGATTT
GTATGTGAAGAATTCCCCCTCTACACACCCCAGTTGCATCCAGCTAACCCTCAATAGGGCCCATAAAGCAAAAGTA
TGGCAACGCCATCTCGTGGTCCGATCTCATGCTCCTCGCCGGCAACGTCGCGCTCGAGTCCATGGGCTTCAAGACCCTGGGCTTCGGCGCCGGCCGGGCCGACACCTTCCAGTCGGACGA
GGGCATCTACTGGGGCGCCGAGACCACCTTCGTGCCCAAGGGTAACGACGTGCGCTACAACGGCAGCGTCGACGCCCGCGGGCGCGCCGCGAACCTCGAGAAGCCCCTGGCCGCCACCCA
CATGGGCCTCATCTACGTGAACCCCGAGGGCCCCGACGGGAACTCCAAGCCCGAGGACTCGGCCCTCGACATCCGCACCGCCTTTGCGCGCATGGGCATGAACGACGAGGAGACCGTGGC
CCTCATCGCCGGCGGCCACGCCTTCGGCAAGGCCCACGGCGCCGTGCCGGGGGGGGACAACATTGGCCCCGAGCCCGAGGCCAACGACATGGGCATGGGCCTCGGCTGGATCAACAAGGT
CAACAAAGGAAACGGCCCCGATACGAGGACTAGCGGCCTCGAGGTCGTGTGGACCAAGACTCCTACCAA
GTAAGCACAAACCCACGCAAAGCCTGTCCGGATCTTTGATCTGTACTAACC
ACTTCTCGATTCTTCAGGTGGAGCAATGGTTTCCTCGAGAGCCTGTACGGCAACCAGTGGCAGCTCGTCACCGGCCCCGGCGGCGCCAAGCACTGGGAGGCTGTCAACGGCACCGTCGAC
TACCCCGACCCGTTCGACAAGACCAAGTTCCGCAAGGCCACCATGCTTACTAGCGACCTGGCCCTGATCCGGGACCCGGCCTACGCCAAAATCACCAAGCGCTGGCTCGACAACCCCCAG
GAGCTGAACGTTGCCTTCGCCAAGGCCTGGTTCAAGCTCCTCCACCGCGACATGGGCCCCCGCTCCCGCTACCTCGGCCCCGAGGTGCCCAAGGAGGAATTTCTCTGGCAGGATCCCGTC
CCTGCCGTCAACCCCTACGGCATTAGCGACGCCGACGTCGTCTCGCTCAAGCAGCTGGTCCTGGCCGCGCCCGGCCTGACCGTGTCGAACCTCGTCTCGACCGCCTGGGCCTCCGCCTCG
ACCTTCCGCCACTCGGACAAGCGCGGCGGCGCCAACGGCGCCCGCATCGCGCTGCAGCCCCAGCGCACCTGGGCCGTCAACAACCCCAAGGAGCTCGACACCGTCCTCAATGCCCTCAAG
GCCGTCCAGACCGACTTCAACAGCAAGGGTGGCAAGCAGGTCTCCCTCGCTGATCTTATCGTCCTTGGCGGTTCGGCTGCTGTCGAGAGGGCCGCGCACGAGGCCGGCCTGCCCAACATT
TCCGTCCCCTTCTCCGCCGGCCGCACCGACGCGACCCAGCAGCAGACCGACGTCGAGTCCTTCCGCTTGATGGAGCCCGTCGCCGACGGCTTCCGCAACTTCGGCCGCGGCAACTCGCGC
TCCCTCACCGAGGAGATCCTCGTCGACCGCGCCTCGCAGCTAGCCCTGACCCCGCCGCAGCTGACGGCCCTCGTCGGCGGCCTGCGCGTCCTGGGCACCAACTCTGACGGCTCCAAGACG
GGCGTCCTGACGGCGCAGCCCGGCAAGCTGACCAACGACTACTTCGTCAACCTGTTGGACATCAACACCGTCTGGAAGCCCGCTAGCGCCGGCGACAAGGAGGTCTGGAAGGGCACCGAC
CGCGCTAGCGGCGCCGAGAAGTTCACCGCCACCCGCGCCGACCTCGTCTTCGGCTCGCACGCCGAGCTGAGGGCCATCACCGAGGTCTATGCCCAGAAGGACTCGGGCGAGCGCTTCGTC
CGCGACTTCGTCAAGGCCTGGGTCAAGGTCATGAACGCGGACCGCTTCGACCTCGGATCCAAATTTGCGAGCAAGAAGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGCTGGCCGGCTGTCTGTTGACAGCCGCGCCCCTCGCCCAGGCCAGCCCCTCGTGCCCCTTCTCGCAGCAGCAAGCGCGCGAGGTTCCCAAGAGCGGCAGCCCTGCCGCCGCAACGCCCT
TTGGCCGCTGCCCACAGAACAGCAACATGGCCGGCGGCGGCACCCGCAGCACCGACTGGTGGCCGTGCCAGCTGAGGCTCGACGTCCTGCGCCAGTTCGCGCCCCAGACGAACCCCCTGG
GTGACGACTTTGACTACACAGAAGCCTTCAAGTCCCTCGATT
ACAATGCGCTCAAGAAGGACCTTACGGAGCTCATGACCAAGTCCCAGGAATGGTGGCCCGCCGACTTTGGCCACTATG
GCGGTCTGTTTATTCGGATGGCTTGGCATAGCGCTGGCACATATCGCGCTATGGATGGTCGTGGCGGTGGCGGAATG
GGTCAACAACGGTTTGCTCCGCTGAACAGCTGGCCCGACAACG
AAAACCTCGACAAGGCTCGCATGTTGATTT
GGCCCATAAAGCAAAAGTATGGCAACGCCATCTCGTGGTCCGATCTCATGCTCCTCGCCGGCAACGTCGCGCTCGAGTCCATGGGCTTCA
AGACCCTGGGCTTCGGCGCCGGCCGGGCCGACACCTTCCAGTCGGACGAGGGCATCTACTGGGGCGCCGAGACCACCTTCGTGCCCAAGGGTAACGACGTGCGCTACAACGGCAGCGTCG
ACGCCCGCGGGCGCGCCGCGAACCTCGAGAAGCCCCTGGCCGCCACCCACATGGGCCTCATCTACGTGAACCCCGAGGGCCCCGACGGGAACTCCAAGCCCGAGGACTCGGCCCTCGACA
TCCGCACCGCCTTTGCGCGCATGGGCATGAACGACGAGGAGACCGTGGCCCTCATCGCCGGCGGCCACGCCTTCGGCAAGGCCCACGGCGCCGTGCCGGGGGGGGACAACATTGGCCCCG
AGCCCGAGGCCAACGACATGGGCATGGGCCTCGGCTGGATCAACAAGGTCAACAAAGGAAACGGCCCCGATACGAGGACTAGCGGCCTCGAGGTCGTGTGGACCAAGACTCCTACCAA
GT
GGAGCAATGGTTTCCTCGAGAGCCTGTACGGCAACCAGTGGCAGCTCGTCACCGGCCCCGGCGGCGCCAAGCACTGGGAGGCTGTCAACGGCACCGTCGACTACCCCGACCCGTTCGACA
AGACCAAGTTCCGCAAGGCCACCATGCTTACTAGCGACCTGGCCCTGATCCGGGACCCGGCCTACGCCAAAATCACCAAGCGCTGGCTCGACAACCCCCAGGAGCTGAACGTTGCCTTCG
CCAAGGCCTGGTTCAAGCTCCTCCACCGCGACATGGGCCCCCGCTCCCGCTACCTCGGCCCCGAGGTGCCCAAGGAGGAATTTCTCTGGCAGGATCCCGTCCCTGCCGTCAACCCCTACG
GCATTAGCGACGCCGACGTCGTCTCGCTCAAGCAGCTGGTCCTGGCCGCGCCCGGCCTGACCGTGTCGAACCTCGTCTCGACCGCCTGGGCCTCCGCCTCGACCTTCCGCCACTCGGACA
AGCGCGGCGGCGCCAACGGCGCCCGCATCGCGCTGCAGCCCCAGCGCACCTGGGCCGTCAACAACCCCAAGGAGCTCGACACCGTCCTCAATGCCCTCAAGGCCGTCCAGACCGACTTCA
ACAGCAAGGGTGGCAAGCAGGTCTCCCTCGCTGATCTTATCGTCCTTGGCGGTTCGGCTGCTGTCGAGAGGGCCGCGCACGAGGCCGGCCTGCCCAACATTTCCGTCCCCTTCTCCGCCG
GCCGCACCGACGCGACCCAGCAGCAGACCGACGTCGAGTCCTTCCGCTTGATGGAGCCCGTCGCCGACGGCTTCCGCAACTTCGGCCGCGGCAACTCGCGCTCCCTCACCGAGGAGATCC
TCGTCGACCGCGCCTCGCAGCTAGCCCTGACCCCGCCGCAGCTGACGGCCCTCGTCGGCGGCCTGCGCGTCCTGGGCACCAACTCTGACGGCTCCAAGACGGGCGTCCTGACGGCGCAGC
CCGGCAAGCTGACCAACGACTACTTCGTCAACCTGTTGGACATCAACACCGTCTGGAAGCCCGCTAGCGCCGGCGACAAGGAGGTCTGGAAGGGCACCGACCGCGCTAGCGGCGCCGAGA
AGTTCACCGCCACCCGCGCCGACCTCGTCTTCGGCTCGCACGCCGAGCTGAGGGCCATCACCGAGGTCTATGCCCAGAAGGACTCGGGCGAGCGCTTCGTCCGCGACTTCGTCAAGGCCT
GGGTCAAGGTCATGAACGCGGACCGCTTCGACCTCGGATCCAAATTTGCGAGCAAGAAGTAA

Retrieve as FASTA